Incidental Mutation 'R6516:Tnks1bp1'
ID 520658
Institutional Source Beutler Lab
Gene Symbol Tnks1bp1
Ensembl Gene ENSMUSG00000033955
Gene Name tankyrase 1 binding protein 1
Synonyms TAB182
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6516 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85048022-85073048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85070727 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1593 (S1593P)
Ref Sequence ENSEMBL: ENSMUSP00000107232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048400] [ENSMUST00000111605]
AlphaFold P58871
Predicted Effect possibly damaging
Transcript: ENSMUST00000048400
AA Change: S931P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045767
Gene: ENSMUSG00000033955
AA Change: S931P

DomainStartEndE-ValueType
low complexity region 77 96 N/A INTRINSIC
low complexity region 292 298 N/A INTRINSIC
low complexity region 809 827 N/A INTRINSIC
low complexity region 868 875 N/A INTRINSIC
Tankyrase_bdg_C 883 1055 1.98e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111605
AA Change: S1593P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107232
Gene: ENSMUSG00000033955
AA Change: S1593P

DomainStartEndE-ValueType
low complexity region 37 44 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 739 758 N/A INTRINSIC
low complexity region 954 960 N/A INTRINSIC
low complexity region 1471 1489 N/A INTRINSIC
low complexity region 1530 1537 N/A INTRINSIC
Tankyrase_bdg_C 1545 1717 1.98e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Tnks1bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Tnks1bp1 APN 2 85062236 nonsense probably null
IGL00974:Tnks1bp1 APN 2 85062882 missense possibly damaging 0.86
IGL01874:Tnks1bp1 APN 2 85058447 missense probably benign 0.01
IGL02419:Tnks1bp1 APN 2 85071781 missense possibly damaging 0.60
IGL02441:Tnks1bp1 APN 2 85071799 missense probably damaging 1.00
IGL02475:Tnks1bp1 APN 2 85059377 missense probably damaging 1.00
IGL03181:Tnks1bp1 APN 2 85062714 missense probably benign 0.00
K3955:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
P0038:Tnks1bp1 UTSW 2 85062411 missense probably benign 0.01
PIT4791001:Tnks1bp1 UTSW 2 85062558 missense probably benign 0.03
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0068:Tnks1bp1 UTSW 2 85062352 missense probably benign 0.12
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0164:Tnks1bp1 UTSW 2 85059221 missense possibly damaging 0.94
R0189:Tnks1bp1 UTSW 2 85070929 missense possibly damaging 0.77
R0454:Tnks1bp1 UTSW 2 85072137 missense probably damaging 1.00
R0650:Tnks1bp1 UTSW 2 85062630 missense possibly damaging 0.68
R0737:Tnks1bp1 UTSW 2 85052536 missense possibly damaging 0.93
R1718:Tnks1bp1 UTSW 2 85071738 missense probably benign 0.44
R1749:Tnks1bp1 UTSW 2 85063067 missense probably benign
R2194:Tnks1bp1 UTSW 2 85063065 missense probably benign 0.06
R2314:Tnks1bp1 UTSW 2 85058915 missense probably benign 0.01
R2379:Tnks1bp1 UTSW 2 85063838 missense probably benign 0.16
R3056:Tnks1bp1 UTSW 2 85070000 nonsense probably null
R3433:Tnks1bp1 UTSW 2 85071016 splice site probably benign
R3751:Tnks1bp1 UTSW 2 85058722 start gained probably benign
R4502:Tnks1bp1 UTSW 2 85062647 nonsense probably null
R4694:Tnks1bp1 UTSW 2 85071722 missense probably damaging 1.00
R4785:Tnks1bp1 UTSW 2 85063034 missense probably damaging 1.00
R5079:Tnks1bp1 UTSW 2 85062626 missense probably damaging 1.00
R5208:Tnks1bp1 UTSW 2 85070632 missense probably damaging 0.96
R5265:Tnks1bp1 UTSW 2 85062754 missense probably benign 0.01
R5512:Tnks1bp1 UTSW 2 85062834 missense probably benign 0.00
R5557:Tnks1bp1 UTSW 2 85063800 missense probably damaging 0.97
R6016:Tnks1bp1 UTSW 2 85052390 missense probably damaging 1.00
R6177:Tnks1bp1 UTSW 2 85059280 start gained probably benign
R6517:Tnks1bp1 UTSW 2 85059345 missense probably benign 0.00
R7032:Tnks1bp1 UTSW 2 85061953 missense probably benign 0.00
R7120:Tnks1bp1 UTSW 2 85072097 missense probably damaging 1.00
R7302:Tnks1bp1 UTSW 2 85052354 missense probably benign 0.24
R7393:Tnks1bp1 UTSW 2 85062866 missense probably benign
R7535:Tnks1bp1 UTSW 2 85063280 nonsense probably null
R7596:Tnks1bp1 UTSW 2 85062713 missense probably benign 0.14
R7680:Tnks1bp1 UTSW 2 85059241 missense probably benign 0.36
R8345:Tnks1bp1 UTSW 2 85062882 missense possibly damaging 0.86
R8413:Tnks1bp1 UTSW 2 85062278 missense probably damaging 1.00
R8768:Tnks1bp1 UTSW 2 85070636 nonsense probably null
R8936:Tnks1bp1 UTSW 2 85063976 missense probably benign 0.00
R8991:Tnks1bp1 UTSW 2 85063946 missense probably benign 0.00
R9007:Tnks1bp1 UTSW 2 85070704 missense probably damaging 1.00
R9118:Tnks1bp1 UTSW 2 85063376 missense probably damaging 1.00
Z1176:Tnks1bp1 UTSW 2 85063530 missense probably damaging 0.99
Z1177:Tnks1bp1 UTSW 2 85059003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCATCAATCAGCTCCTG -3'
(R):5'- TGAGGCTCCTCTACAACCTC -3'

Sequencing Primer
(F):5'- CAATCAGCTCCTGGTTTATGTTGAG -3'
(R):5'- CTCTACAACCTCCTCATCTGAAG -3'
Posted On 2018-06-06