Mutagenetix > Incidental Mutations

Incidental Mutation 'R6540:Ndst4'

520666

Institutional Source

Beutler Lab

Gene Symbol

Ndst4

Ensembl Gene

ENSMUSG00000027971

Gene Name

N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R6540 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125404076-125728899 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 125722152 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 309 (K309*)

Ref Sequence

ENSEMBL: ENSMUSP00000133575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000173932] [ENSMUST00000174648] [ENSMUST00000198101]

Predicted Effect

probably null
Transcript: ENSMUST00000173932
AA Change: K817*

SMART Domains

Protein: ENSMUSP00000133341
Gene: ENSMUSG00000027971
AA Change: K817*

Domain	Start	End	E-Value	Type
Pfam:HSNSD	20	505	1.2e-251	PFAM
Pfam:Sulfotransfer_1	594	857	1.2e-43	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000174648
AA Change: K309*

SMART Domains

Protein: ENSMUSP00000133575
Gene: ENSMUSG00000027971
AA Change: K309*

Domain	Start	End	E-Value	Type
Pfam:Sulfotransfer_1	86	349	6.6e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000198101

SMART Domains

Protein: ENSMUSP00000142414
Gene: ENSMUSG00000027971

Domain	Start	End	E-Value	Type
Pfam:Sulfotransfer_1	3	148	7e-22	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit a phenotype restricted to the colonic epithelium that includes an increased number of colon goblet cells, a decreased number of colonocytes, and increased apoptosis of colonic epithelial cells in the proximal colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A3galt2	T	C	4: 128,766,986	Y143H	possibly damaging	Het
Aco1	G	A	4: 40,186,367	R593Q	probably benign	Het
Adamts2	T	C	11: 50,788,740	V849A	possibly damaging	Het
AF366264	A	C	8: 13,837,573	S173A	probably benign	Het
Ash1l	A	T	3: 88,985,061	T1416S	probably damaging	Het
Cdc5l	A	G	17: 45,426,644	W63R	probably damaging	Het
Cep95	T	A	11: 106,801,502	D169E	probably damaging	Het
Col14a1	A	C	15: 55,372,581	N297T	unknown	Het
Cp	T	C	3: 19,964,529		probably null	Het
Fbxl19	G	T	7: 127,748,353		probably benign	Het
Flnc	T	C	6: 29,446,377	V931A	possibly damaging	Het
Foxj2	A	G	6: 122,833,243	H187R	probably benign	Het
Hectd4	G	A	5: 121,303,571	V1199I	probably benign	Het
Ighv7-4	A	G	12: 114,222,850	Y101H	possibly damaging	Het
Igkv10-94	T	A	6: 68,704,523	Y111F	probably benign	Het
Lin28a	C	T	4: 134,018,061	V74M	possibly damaging	Het
Lrrc49	T	C	9: 60,685,052	N53S	possibly damaging	Het
Mroh9	T	G	1: 163,038,972	T701P	possibly damaging	Het
Nlrp9a	T	C	7: 26,557,392	V145A	possibly damaging	Het
Olfr167	T	C	16: 19,514,821	I272V	probably benign	Het
Ovgp1	A	T	3: 105,986,581	K557*	probably null	Het
Pde4b	T	C	4: 102,601,876	L546P	probably damaging	Het
Pkd1	G	A	17: 24,575,977	V2213M	probably damaging	Het
Plekhh1	A	G	12: 79,064,489	I542V	probably benign	Het
Ppan	A	G	9: 20,891,210		probably null	Het
Prdm15	A	T	16: 97,835,805	V104E	probably benign	Het
Sik3	A	G	9: 46,212,053	H1050R	probably benign	Het
Slc35d3	A	G	10: 19,849,340	F257L	possibly damaging	Het
Tfip11	A	G	5: 112,334,397		probably null	Het
Tmem132d	A	G	5: 128,268,532	S309P	possibly damaging	Het
Tmem87a	T	C	2: 120,403,919	I48V	probably benign	Het
V1rd19	T	A	7: 24,003,631	L174*	probably null	Het
Zfp729a	A	G	13: 67,619,648	C821R	possibly damaging	Het
Zfp970	C	A	2: 177,475,595	H321N	probably damaging	Het
Zzef1	T	C	11: 72,913,229	L2599P	probably damaging	Het

Other mutations in Ndst4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Ndst4	APN	3	125438211	missense	probably damaging	0.98
IGL00926:Ndst4	APN	3	125561453	missense	probably benign	0.01
IGL01292:Ndst4	APN	3	125438754	missense	probably damaging	1.00
IGL01797:Ndst4	APN	3	125683153	missense	probably damaging	0.99
R0004:Ndst4	UTSW	3	125570826	missense	probably benign	0.03
R0118:Ndst4	UTSW	3	125611561	nonsense	probably null
R0652:Ndst4	UTSW	3	125611539	missense	possibly damaging	0.93
R1437:Ndst4	UTSW	3	125561450	missense	probably damaging	0.97
R1502:Ndst4	UTSW	3	125437758	start gained	probably benign
R1900:Ndst4	UTSW	3	125697895	splice site	probably null
R1960:Ndst4	UTSW	3	125438682	nonsense	probably null
R2249:Ndst4	UTSW	3	125438174	missense	probably benign	0.16
R2334:Ndst4	UTSW	3	125708176	missense	possibly damaging	0.86
R2345:Ndst4	UTSW	3	125708120	missense	possibly damaging	0.95
R3617:Ndst4	UTSW	3	125438133	missense	probably benign	0.00
R3713:Ndst4	UTSW	3	125561505	missense	possibly damaging	0.93
R3715:Ndst4	UTSW	3	125561505	missense	possibly damaging	0.93
R3954:Ndst4	UTSW	3	125437905	missense	probably benign	0.01
R4013:Ndst4	UTSW	3	125683170	missense	probably damaging	1.00
R4035:Ndst4	UTSW	3	125438736	missense	probably damaging	1.00
R4085:Ndst4	UTSW	3	125609482	missense	probably benign
R4496:Ndst4	UTSW	3	125683273	missense	probably damaging	1.00
R4498:Ndst4	UTSW	3	125438358	missense	probably damaging	1.00
R5187:Ndst4	UTSW	3	125437911	missense	probably damaging	0.98
R5233:Ndst4	UTSW	3	125710117	missense	probably damaging	1.00
R5518:Ndst4	UTSW	3	125438456	missense	probably benign
R5575:Ndst4	UTSW	3	125437830	missense	probably benign	0.41
R5687:Ndst4	UTSW	3	125438609	missense	possibly damaging	0.79
R5940:Ndst4	UTSW	3	125561419	splice site	probably benign
R6027:Ndst4	UTSW	3	125713376	missense	probably benign	0.38
R6406:Ndst4	UTSW	3	125438501	missense	probably benign
R6941:Ndst4	UTSW	3	125609511	missense	possibly damaging	0.93
R7108:Ndst4	UTSW	3	125561471	missense	probably damaging	0.96
R7269:Ndst4	UTSW	3	125438358	missense	probably damaging	1.00
R7278:Ndst4	UTSW	3	125438303	missense	probably benign	0.00
R7345:Ndst4	UTSW	3	125714659	missense	probably benign	0.07
R7405:Ndst4	UTSW	3	125683216	missense	probably benign
R7418:Ndst4	UTSW	3	125708151	missense	probably damaging	0.99
R7592:Ndst4	UTSW	3	125570787	missense	probably damaging	0.99
R7714:Ndst4	UTSW	3	125570844	missense	probably benign	0.08
X0027:Ndst4	UTSW	3	125437946	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTAAAATCAACTGAACCACTGTAG -3'
(R):5'- GTGCTTTCCAATGTGTAATAGAGAAAC -3'

Sequencing Primer
(F):5'- CTGAACCACTGTAGAAATGACTTAAG -3'
(R):5'- CAGATGGCAACTTGTTCT -3'

Posted On

2018-06-06