Incidental Mutation 'R6540:Tfip11'
ID520676
Institutional Source Beutler Lab
Gene Symbol Tfip11
Ensembl Gene ENSMUSG00000029345
Gene Nametuftelin interacting protein 11
SynonymsTip39
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6540 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location112326358-112338073 bp(+) (GRCm38)
Type of Mutationsplice site (2482 bp from exon)
DNA Base Change (assembly) A to G at 112334397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031288] [ENSMUST00000031289] [ENSMUST00000146510] [ENSMUST00000198238]
Predicted Effect probably damaging
Transcript: ENSMUST00000031288
AA Change: D507G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031288
Gene: ENSMUSG00000029345
AA Change: D507G

DomainStartEndE-ValueType
Pfam:TIP_N 17 114 1.4e-30 PFAM
G_patch 148 194 3.3e-18 SMART
low complexity region 212 218 N/A INTRINSIC
low complexity region 228 242 N/A INTRINSIC
Pfam:GCFC 398 667 3.4e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000031289
SMART Domains Protein: ENSMUSP00000031289
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:SRR1 109 164 2.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126736
Predicted Effect probably benign
Transcript: ENSMUST00000146510
SMART Domains Protein: ENSMUSP00000119870
Gene: ENSMUSG00000029346

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
Pfam:SRR1 109 162 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156083
Predicted Effect probably null
Transcript: ENSMUST00000198238
SMART Domains Protein: ENSMUSP00000142844
Gene: ENSMUSG00000029345

DomainStartEndE-ValueType
G_patch 8 54 1.9e-20 SMART
low complexity region 72 78 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the spliceosome that promotes the release of the lariat-intron during late-stage splicing through the recruitment of a pre-mRNA splicing factor called DEAH-box helicase 15. The encoded protein contains a G-patch domain, a hallmark of RNA-processing proteins, that binds DEAH-box helicase 15. This protein contains an atypical nuclear localization sequence as well as a nuclear speckle-targeting sequence, enabling it to localize to distinct speckled regions within the cell nucleus. Polymorphisms in this gene are associated with dental caries suggesting a role in amelogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,766,986 Y143H possibly damaging Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adamts2 T C 11: 50,788,740 V849A possibly damaging Het
AF366264 A C 8: 13,837,573 S173A probably benign Het
Ash1l A T 3: 88,985,061 T1416S probably damaging Het
Cdc5l A G 17: 45,426,644 W63R probably damaging Het
Cep95 T A 11: 106,801,502 D169E probably damaging Het
Col14a1 A C 15: 55,372,581 N297T unknown Het
Cp T C 3: 19,964,529 probably null Het
Fbxl19 G T 7: 127,748,353 probably benign Het
Flnc T C 6: 29,446,377 V931A possibly damaging Het
Foxj2 A G 6: 122,833,243 H187R probably benign Het
Hectd4 G A 5: 121,303,571 V1199I probably benign Het
Ighv7-4 A G 12: 114,222,850 Y101H possibly damaging Het
Igkv10-94 T A 6: 68,704,523 Y111F probably benign Het
Lin28a C T 4: 134,018,061 V74M possibly damaging Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mroh9 T G 1: 163,038,972 T701P possibly damaging Het
Ndst4 A T 3: 125,722,152 K309* probably null Het
Nlrp9a T C 7: 26,557,392 V145A possibly damaging Het
Olfr167 T C 16: 19,514,821 I272V probably benign Het
Ovgp1 A T 3: 105,986,581 K557* probably null Het
Pde4b T C 4: 102,601,876 L546P probably damaging Het
Pkd1 G A 17: 24,575,977 V2213M probably damaging Het
Plekhh1 A G 12: 79,064,489 I542V probably benign Het
Ppan A G 9: 20,891,210 probably null Het
Prdm15 A T 16: 97,835,805 V104E probably benign Het
Sik3 A G 9: 46,212,053 H1050R probably benign Het
Slc35d3 A G 10: 19,849,340 F257L possibly damaging Het
Tmem132d A G 5: 128,268,532 S309P possibly damaging Het
Tmem87a T C 2: 120,403,919 I48V probably benign Het
V1rd19 T A 7: 24,003,631 L174* probably null Het
Zfp729a A G 13: 67,619,648 C821R possibly damaging Het
Zfp970 C A 2: 177,475,595 H321N probably damaging Het
Zzef1 T C 11: 72,913,229 L2599P probably damaging Het
Other mutations in Tfip11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Tfip11 APN 5 112329503 missense possibly damaging 0.51
IGL02627:Tfip11 APN 5 112329813 missense possibly damaging 0.69
R0023:Tfip11 UTSW 5 112332009 missense possibly damaging 0.47
R0254:Tfip11 UTSW 5 112335655 missense probably benign 0.06
R0465:Tfip11 UTSW 5 112333264 missense probably benign 0.32
R0569:Tfip11 UTSW 5 112328094 missense probably damaging 1.00
R1411:Tfip11 UTSW 5 112333033 missense probably benign 0.00
R1751:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1767:Tfip11 UTSW 5 112334432 missense probably damaging 1.00
R1792:Tfip11 UTSW 5 112329397 missense possibly damaging 0.95
R2125:Tfip11 UTSW 5 112335663 missense possibly damaging 0.46
R4781:Tfip11 UTSW 5 112333399 missense probably damaging 0.99
R4975:Tfip11 UTSW 5 112335747 unclassified probably benign
R5348:Tfip11 UTSW 5 112335668 missense probably benign 0.01
R5385:Tfip11 UTSW 5 112331220 critical splice donor site probably null
R5469:Tfip11 UTSW 5 112334325 nonsense probably null
R6810:Tfip11 UTSW 5 112333597 missense probably benign 0.07
R7199:Tfip11 UTSW 5 112331178 missense probably benign 0.16
R7342:Tfip11 UTSW 5 112327972 start codon destroyed probably null 0.99
R7352:Tfip11 UTSW 5 112333268 missense probably benign
R7921:Tfip11 UTSW 5 112335576 missense probably benign 0.03
R8070:Tfip11 UTSW 5 112334930 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGACATCATGGCAGCCTC -3'
(R):5'- TGGAGAAGGCTAGAACTACTACTG -3'

Sequencing Primer
(F):5'- ACATCATGGCAGCCTCTGTGG -3'
(R):5'- GGCTAGAACTACTACTGCAGGC -3'
Posted On2018-06-06