Incidental Mutation 'R6540:Foxj2'
ID520686
Institutional Source Beutler Lab
Gene Symbol Foxj2
Ensembl Gene ENSMUSG00000003154
Gene Nameforkhead box J2
SynonymsFhx
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R6540 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location122819914-122845366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122833243 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 187 (H187R)
Ref Sequence ENSEMBL: ENSMUSP00000145438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000177927] [ENSMUST00000203075]
Predicted Effect probably benign
Transcript: ENSMUST00000003238
AA Change: H187R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154
AA Change: H187R

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177927
AA Change: H187R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154
AA Change: H187R

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196252
Predicted Effect probably benign
Transcript: ENSMUST00000203075
AA Change: H187R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145438
Gene: ENSMUSG00000003154
AA Change: H187R

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 7.8e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,766,986 Y143H possibly damaging Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adamts2 T C 11: 50,788,740 V849A possibly damaging Het
AF366264 A C 8: 13,837,573 S173A probably benign Het
Ash1l A T 3: 88,985,061 T1416S probably damaging Het
Cdc5l A G 17: 45,426,644 W63R probably damaging Het
Cep95 T A 11: 106,801,502 D169E probably damaging Het
Col14a1 A C 15: 55,372,581 N297T unknown Het
Cp T C 3: 19,964,529 probably null Het
Fbxl19 G T 7: 127,748,353 probably benign Het
Flnc T C 6: 29,446,377 V931A possibly damaging Het
Hectd4 G A 5: 121,303,571 V1199I probably benign Het
Ighv7-4 A G 12: 114,222,850 Y101H possibly damaging Het
Igkv10-94 T A 6: 68,704,523 Y111F probably benign Het
Lin28a C T 4: 134,018,061 V74M possibly damaging Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mroh9 T G 1: 163,038,972 T701P possibly damaging Het
Ndst4 A T 3: 125,722,152 K309* probably null Het
Nlrp9a T C 7: 26,557,392 V145A possibly damaging Het
Olfr167 T C 16: 19,514,821 I272V probably benign Het
Ovgp1 A T 3: 105,986,581 K557* probably null Het
Pde4b T C 4: 102,601,876 L546P probably damaging Het
Pkd1 G A 17: 24,575,977 V2213M probably damaging Het
Plekhh1 A G 12: 79,064,489 I542V probably benign Het
Ppan A G 9: 20,891,210 probably null Het
Prdm15 A T 16: 97,835,805 V104E probably benign Het
Sik3 A G 9: 46,212,053 H1050R probably benign Het
Slc35d3 A G 10: 19,849,340 F257L possibly damaging Het
Tfip11 A G 5: 112,334,397 probably null Het
Tmem132d A G 5: 128,268,532 S309P possibly damaging Het
Tmem87a T C 2: 120,403,919 I48V probably benign Het
V1rd19 T A 7: 24,003,631 L174* probably null Het
Zfp729a A G 13: 67,619,648 C821R possibly damaging Het
Zfp970 C A 2: 177,475,595 H321N probably damaging Het
Zzef1 T C 11: 72,913,229 L2599P probably damaging Het
Other mutations in Foxj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Foxj2 APN 6 122839635 missense probably damaging 1.00
IGL01100:Foxj2 APN 6 122828391 missense probably damaging 1.00
IGL02169:Foxj2 APN 6 122828466 missense probably damaging 0.98
IGL02220:Foxj2 APN 6 122838581 splice site probably benign
IGL02423:Foxj2 APN 6 122842773 missense possibly damaging 0.90
IGL03026:Foxj2 APN 6 122838180 missense probably benign 0.38
IGL03198:Foxj2 APN 6 122833007 critical splice donor site probably null
R0400:Foxj2 UTSW 6 122833808 missense possibly damaging 0.69
R1572:Foxj2 UTSW 6 122833261 missense probably benign 0.00
R2063:Foxj2 UTSW 6 122840241 missense probably benign 0.01
R2568:Foxj2 UTSW 6 122828372 missense probably damaging 1.00
R2877:Foxj2 UTSW 6 122842832 missense probably damaging 0.96
R4745:Foxj2 UTSW 6 122837989 missense probably damaging 1.00
R4763:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4764:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4765:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R4775:Foxj2 UTSW 6 122833271 missense probably benign 0.27
R5056:Foxj2 UTSW 6 122833874 missense probably benign 0.00
R5816:Foxj2 UTSW 6 122833736 missense probably benign
R6254:Foxj2 UTSW 6 122838139 missense probably damaging 0.98
R6265:Foxj2 UTSW 6 122828174 missense probably damaging 0.99
R6882:Foxj2 UTSW 6 122828505 critical splice donor site probably null
R6981:Foxj2 UTSW 6 122828444 missense probably damaging 1.00
R6981:Foxj2 UTSW 6 122842839 missense probably benign 0.14
R7295:Foxj2 UTSW 6 122840231 missense probably benign 0.14
R7475:Foxj2 UTSW 6 122837842 missense probably benign 0.14
Z1176:Foxj2 UTSW 6 122832936 critical splice acceptor site probably null
Z1176:Foxj2 UTSW 6 122833711 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTCTTCTTTGGGAGAGCTC -3'
(R):5'- CCAATCTATCTGCCTAGCACATG -3'

Sequencing Primer
(F):5'- CTGTGACTAAATGCGGGTTAGC -3'
(R):5'- TCTATCTGCCTAGCACATGACAAGG -3'
Posted On2018-06-06