Incidental Mutation 'R6540:Semp2l2a'
ID 520694
Institutional Source Beutler Lab
Gene Symbol Semp2l2a
Ensembl Gene ENSMUSG00000057116
Gene Name SUMO/sentrin specific peptidase 2-like 2A
Synonyms AF366264
MMRRC Submission 044666-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.535) question?
Stock # R6540 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13885233-13888389 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 13887573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 173 (S173A)
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
AlphaFold G3X9P9
Predicted Effect probably benign
Transcript: ENSMUST00000071308
AA Change: S173A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116
AA Change: S173A

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,660,779 (GRCm39) Y143H possibly damaging Het
Aco1 G A 4: 40,186,367 (GRCm39) R593Q probably benign Het
Adamts2 T C 11: 50,679,567 (GRCm39) V849A possibly damaging Het
Ash1l A T 3: 88,892,368 (GRCm39) T1416S probably damaging Het
Cdc5l A G 17: 45,737,570 (GRCm39) W63R probably damaging Het
Cep95 T A 11: 106,692,328 (GRCm39) D169E probably damaging Het
Col14a1 A C 15: 55,235,977 (GRCm39) N297T unknown Het
Cp T C 3: 20,018,693 (GRCm39) probably null Het
Fbxl19 G T 7: 127,347,525 (GRCm39) probably benign Het
Flnc T C 6: 29,446,376 (GRCm39) V931A possibly damaging Het
Foxj2 A G 6: 122,810,202 (GRCm39) H187R probably benign Het
Hectd4 G A 5: 121,441,634 (GRCm39) V1199I probably benign Het
Ighv7-4 A G 12: 114,186,470 (GRCm39) Y101H possibly damaging Het
Igkv10-94 T A 6: 68,681,507 (GRCm39) Y111F probably benign Het
Lin28a C T 4: 133,745,372 (GRCm39) V74M possibly damaging Het
Lrrc49 T C 9: 60,592,335 (GRCm39) N53S possibly damaging Het
Mroh9 T G 1: 162,866,541 (GRCm39) T701P possibly damaging Het
Ndst4 A T 3: 125,515,801 (GRCm39) K309* probably null Het
Nlrp9a T C 7: 26,256,817 (GRCm39) V145A possibly damaging Het
Or2l5 T C 16: 19,333,571 (GRCm39) I272V probably benign Het
Ovgp1 A T 3: 105,893,897 (GRCm39) K557* probably null Het
Pde4b T C 4: 102,459,073 (GRCm39) L546P probably damaging Het
Pkd1 G A 17: 24,794,951 (GRCm39) V2213M probably damaging Het
Plekhh1 A G 12: 79,111,263 (GRCm39) I542V probably benign Het
Ppan A G 9: 20,802,506 (GRCm39) probably null Het
Prdm15 A T 16: 97,637,005 (GRCm39) V104E probably benign Het
Sik3 A G 9: 46,123,351 (GRCm39) H1050R probably benign Het
Slc35d3 A G 10: 19,725,086 (GRCm39) F257L possibly damaging Het
Tfip11 A G 5: 112,482,263 (GRCm39) probably null Het
Tmem132d A G 5: 128,345,596 (GRCm39) S309P possibly damaging Het
Tmem87a T C 2: 120,234,400 (GRCm39) I48V probably benign Het
V1rd19 T A 7: 23,703,056 (GRCm39) L174* probably null Het
Zfp729a A G 13: 67,767,767 (GRCm39) C821R possibly damaging Het
Zfp970 C A 2: 177,167,388 (GRCm39) H321N probably damaging Het
Zzef1 T C 11: 72,804,055 (GRCm39) L2599P probably damaging Het
Other mutations in Semp2l2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:Semp2l2a APN 8 13,887,704 (GRCm39) missense probably benign 0.03
IGL02647:Semp2l2a APN 8 13,886,979 (GRCm39) missense probably damaging 0.96
IGL03118:Semp2l2a APN 8 13,888,096 (GRCm39) utr 5 prime probably benign
FR4342:Semp2l2a UTSW 8 13,887,613 (GRCm39) missense probably benign 0.00
R0636:Semp2l2a UTSW 8 13,887,870 (GRCm39) missense probably benign 0.00
R1796:Semp2l2a UTSW 8 13,886,816 (GRCm39) nonsense probably null
R1913:Semp2l2a UTSW 8 13,887,143 (GRCm39) missense probably benign 0.16
R2353:Semp2l2a UTSW 8 13,886,951 (GRCm39) missense probably damaging 1.00
R2944:Semp2l2a UTSW 8 13,887,212 (GRCm39) missense probably damaging 1.00
R3714:Semp2l2a UTSW 8 13,886,736 (GRCm39) missense probably benign 0.04
R4222:Semp2l2a UTSW 8 13,888,061 (GRCm39) missense probably benign
R4628:Semp2l2a UTSW 8 13,886,625 (GRCm39) missense probably damaging 1.00
R4801:Semp2l2a UTSW 8 13,886,970 (GRCm39) missense possibly damaging 0.93
R4802:Semp2l2a UTSW 8 13,886,970 (GRCm39) missense possibly damaging 0.93
R4836:Semp2l2a UTSW 8 13,888,007 (GRCm39) missense probably benign
R5143:Semp2l2a UTSW 8 13,886,844 (GRCm39) missense possibly damaging 0.87
R5637:Semp2l2a UTSW 8 13,887,713 (GRCm39) missense possibly damaging 0.46
R5930:Semp2l2a UTSW 8 13,887,263 (GRCm39) missense probably benign 0.06
R6556:Semp2l2a UTSW 8 13,887,690 (GRCm39) nonsense probably null
R6724:Semp2l2a UTSW 8 13,887,083 (GRCm39) missense probably damaging 1.00
R7131:Semp2l2a UTSW 8 13,886,982 (GRCm39) missense probably damaging 0.98
R7148:Semp2l2a UTSW 8 13,887,996 (GRCm39) missense probably benign 0.01
R7660:Semp2l2a UTSW 8 13,887,995 (GRCm39) missense probably benign 0.06
R8198:Semp2l2a UTSW 8 13,887,056 (GRCm39) missense probably benign 0.11
R8483:Semp2l2a UTSW 8 13,888,229 (GRCm39) start gained probably benign
R9090:Semp2l2a UTSW 8 13,886,697 (GRCm39) missense possibly damaging 0.53
R9271:Semp2l2a UTSW 8 13,886,697 (GRCm39) missense possibly damaging 0.53
X0020:Semp2l2a UTSW 8 13,886,847 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGGCTCCAAACTGTTCCC -3'
(R):5'- ACCCCTAGAGTTGACCGAAG -3'

Sequencing Primer
(F):5'- GCTCCAAACTGTTCCCCCTTC -3'
(R):5'- TCCAGAGCAGGCTGTGACTG -3'
Posted On 2018-06-06