Incidental Mutation 'R6540:AF366264'
ID 520694
Institutional Source Beutler Lab
Gene Symbol AF366264
Ensembl Gene ENSMUSG00000057116
Gene Name cDNA sequence AF366264
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock # R6540 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 13835233-13838389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 13837573 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 173 (S173A)
Ref Sequence ENSEMBL: ENSMUSP00000096518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071308]
AlphaFold G3X9P9
Predicted Effect probably benign
Transcript: ENSMUST00000071308
AA Change: S173A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000096518
Gene: ENSMUSG00000057116
AA Change: S173A

DomainStartEndE-ValueType
Pfam:Peptidase_C48 322 501 1.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,766,986 Y143H possibly damaging Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adamts2 T C 11: 50,788,740 V849A possibly damaging Het
Ash1l A T 3: 88,985,061 T1416S probably damaging Het
Cdc5l A G 17: 45,426,644 W63R probably damaging Het
Cep95 T A 11: 106,801,502 D169E probably damaging Het
Col14a1 A C 15: 55,372,581 N297T unknown Het
Cp T C 3: 19,964,529 probably null Het
Fbxl19 G T 7: 127,748,353 probably benign Het
Flnc T C 6: 29,446,377 V931A possibly damaging Het
Foxj2 A G 6: 122,833,243 H187R probably benign Het
Hectd4 G A 5: 121,303,571 V1199I probably benign Het
Ighv7-4 A G 12: 114,222,850 Y101H possibly damaging Het
Igkv10-94 T A 6: 68,704,523 Y111F probably benign Het
Lin28a C T 4: 134,018,061 V74M possibly damaging Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mroh9 T G 1: 163,038,972 T701P possibly damaging Het
Ndst4 A T 3: 125,722,152 K309* probably null Het
Nlrp9a T C 7: 26,557,392 V145A possibly damaging Het
Olfr167 T C 16: 19,514,821 I272V probably benign Het
Ovgp1 A T 3: 105,986,581 K557* probably null Het
Pde4b T C 4: 102,601,876 L546P probably damaging Het
Pkd1 G A 17: 24,575,977 V2213M probably damaging Het
Plekhh1 A G 12: 79,064,489 I542V probably benign Het
Ppan A G 9: 20,891,210 probably null Het
Prdm15 A T 16: 97,835,805 V104E probably benign Het
Sik3 A G 9: 46,212,053 H1050R probably benign Het
Slc35d3 A G 10: 19,849,340 F257L possibly damaging Het
Tfip11 A G 5: 112,334,397 probably null Het
Tmem132d A G 5: 128,268,532 S309P possibly damaging Het
Tmem87a T C 2: 120,403,919 I48V probably benign Het
V1rd19 T A 7: 24,003,631 L174* probably null Het
Zfp729a A G 13: 67,619,648 C821R possibly damaging Het
Zfp970 C A 2: 177,475,595 H321N probably damaging Het
Zzef1 T C 11: 72,913,229 L2599P probably damaging Het
Other mutations in AF366264
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02291:AF366264 APN 8 13837704 missense probably benign 0.03
IGL02647:AF366264 APN 8 13836979 missense probably damaging 0.96
IGL03118:AF366264 APN 8 13838096 utr 5 prime probably benign
FR4342:AF366264 UTSW 8 13837613 missense probably benign 0.00
R0636:AF366264 UTSW 8 13837870 missense probably benign 0.00
R1796:AF366264 UTSW 8 13836816 nonsense probably null
R1913:AF366264 UTSW 8 13837143 missense probably benign 0.16
R2353:AF366264 UTSW 8 13836951 missense probably damaging 1.00
R2944:AF366264 UTSW 8 13837212 missense probably damaging 1.00
R3714:AF366264 UTSW 8 13836736 missense probably benign 0.04
R4222:AF366264 UTSW 8 13838061 missense probably benign
R4628:AF366264 UTSW 8 13836625 missense probably damaging 1.00
R4801:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4802:AF366264 UTSW 8 13836970 missense possibly damaging 0.93
R4836:AF366264 UTSW 8 13838007 missense probably benign
R5143:AF366264 UTSW 8 13836844 missense possibly damaging 0.87
R5637:AF366264 UTSW 8 13837713 missense possibly damaging 0.46
R5930:AF366264 UTSW 8 13837263 missense probably benign 0.06
R6556:AF366264 UTSW 8 13837690 nonsense probably null
R6724:AF366264 UTSW 8 13837083 missense probably damaging 1.00
R7131:AF366264 UTSW 8 13836982 missense probably damaging 0.98
R7148:AF366264 UTSW 8 13837996 missense probably benign 0.01
R7660:AF366264 UTSW 8 13837995 missense probably benign 0.06
R8198:AF366264 UTSW 8 13837056 missense probably benign 0.11
R8483:AF366264 UTSW 8 13838229 start gained probably benign
R9090:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
R9271:AF366264 UTSW 8 13836697 missense possibly damaging 0.53
X0020:AF366264 UTSW 8 13836847 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGGCTCCAAACTGTTCCC -3'
(R):5'- ACCCCTAGAGTTGACCGAAG -3'

Sequencing Primer
(F):5'- GCTCCAAACTGTTCCCCCTTC -3'
(R):5'- TCCAGAGCAGGCTGTGACTG -3'
Posted On 2018-06-06