Incidental Mutation 'R6540:Olfr167'
ID 520718
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor 167
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R6540 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 19509558-19522266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19514821 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 272 (I272V)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect probably benign
Transcript: ENSMUST00000054606
AA Change: I272V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: I272V

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214315
AA Change: I272V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 T C 4: 128,766,986 Y143H possibly damaging Het
Aco1 G A 4: 40,186,367 R593Q probably benign Het
Adamts2 T C 11: 50,788,740 V849A possibly damaging Het
AF366264 A C 8: 13,837,573 S173A probably benign Het
Ash1l A T 3: 88,985,061 T1416S probably damaging Het
Cdc5l A G 17: 45,426,644 W63R probably damaging Het
Cep95 T A 11: 106,801,502 D169E probably damaging Het
Col14a1 A C 15: 55,372,581 N297T unknown Het
Cp T C 3: 19,964,529 probably null Het
Fbxl19 G T 7: 127,748,353 probably benign Het
Flnc T C 6: 29,446,377 V931A possibly damaging Het
Foxj2 A G 6: 122,833,243 H187R probably benign Het
Hectd4 G A 5: 121,303,571 V1199I probably benign Het
Ighv7-4 A G 12: 114,222,850 Y101H possibly damaging Het
Igkv10-94 T A 6: 68,704,523 Y111F probably benign Het
Lin28a C T 4: 134,018,061 V74M possibly damaging Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mroh9 T G 1: 163,038,972 T701P possibly damaging Het
Ndst4 A T 3: 125,722,152 K309* probably null Het
Nlrp9a T C 7: 26,557,392 V145A possibly damaging Het
Ovgp1 A T 3: 105,986,581 K557* probably null Het
Pde4b T C 4: 102,601,876 L546P probably damaging Het
Pkd1 G A 17: 24,575,977 V2213M probably damaging Het
Plekhh1 A G 12: 79,064,489 I542V probably benign Het
Ppan A G 9: 20,891,210 probably null Het
Prdm15 A T 16: 97,835,805 V104E probably benign Het
Sik3 A G 9: 46,212,053 H1050R probably benign Het
Slc35d3 A G 10: 19,849,340 F257L possibly damaging Het
Tfip11 A G 5: 112,334,397 probably null Het
Tmem132d A G 5: 128,268,532 S309P possibly damaging Het
Tmem87a T C 2: 120,403,919 I48V probably benign Het
V1rd19 T A 7: 24,003,631 L174* probably null Het
Zfp729a A G 13: 67,619,648 C821R possibly damaging Het
Zfp970 C A 2: 177,475,595 H321N probably damaging Het
Zzef1 T C 11: 72,913,229 L2599P probably damaging Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5019:Olfr167 UTSW 16 19515535 missense probably damaging 0.99
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
R8671:Olfr167 UTSW 16 19515054 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GAGATCGATCCGAGTACTTAACC -3'
(R):5'- TGTGAGTACAATCCTCTTTCTTGTG -3'

Sequencing Primer
(F):5'- TCTGGATTCACGGAAGCA -3'
(R):5'- CATTGGAATAGTGTGTTCCTATGGTC -3'
Posted On 2018-06-06