Incidental Mutation 'R6516:Ddo'
ID520725
Institutional Source Beutler Lab
Gene Symbol Ddo
Ensembl Gene ENSMUSG00000063428
Gene NameD-aspartate oxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6516 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40630011-40681847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40631745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 46 (V46E)
Ref Sequence ENSEMBL: ENSMUSP00000149768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019977] [ENSMUST00000213442] [ENSMUST00000213503] [ENSMUST00000213856] [ENSMUST00000214102] [ENSMUST00000216830]
Predicted Effect probably damaging
Transcript: ENSMUST00000019977
AA Change: V46E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000019977
Gene: ENSMUSG00000063428
AA Change: V46E

DomainStartEndE-ValueType
Pfam:DAO 5 324 5.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213442
AA Change: V46E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000213503
AA Change: V46E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213856
AA Change: V46E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000214102
AA Change: V46E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214618
Predicted Effect probably damaging
Transcript: ENSMUST00000216830
AA Change: V46E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peroxisomal flavoprotein that catalyzes the oxidative deamination of D-aspartate and N-methyl D-aspartate. Flavin adenine dinucleotide or 6-hydroxyflavin adenine dinucleotide can serve as the cofactor in this reaction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile, but can display impaired male copulation, decreased autogrooming, increased body weight, and increased D-aspartate levels, depending on the mutant allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Ddo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Ddo APN 10 40647554 missense probably damaging 1.00
IGL01784:Ddo APN 10 40631788 splice site probably benign
IGL01891:Ddo APN 10 40647647 missense possibly damaging 0.95
IGL02559:Ddo APN 10 40647521 missense probably damaging 1.00
IGL02639:Ddo APN 10 40647737 missense probably damaging 1.00
IGL02884:Ddo APN 10 40637364 missense probably benign 0.01
R1796:Ddo UTSW 10 40647629 missense probably benign 0.32
R2512:Ddo UTSW 10 40632939 missense possibly damaging 0.56
R3054:Ddo UTSW 10 40631742 missense probably benign 0.37
R4454:Ddo UTSW 10 40647547 missense probably damaging 0.97
R5517:Ddo UTSW 10 40647730 missense probably benign 0.00
R6336:Ddo UTSW 10 40633031 missense probably damaging 0.98
R6872:Ddo UTSW 10 40637418 missense possibly damaging 0.71
R7405:Ddo UTSW 10 40647997 missense possibly damaging 0.48
R7735:Ddo UTSW 10 40631774 missense probably benign 0.00
Z1176:Ddo UTSW 10 40647933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCCGGGGAGAATAATGCC -3'
(R):5'- GAAAATGCAGCTGATCCAGG -3'

Sequencing Primer
(F):5'- CCCTAAGCAAGGTGGTCCATTTG -3'
(R):5'- ATGCAGCTGATCCAGGAGACC -3'
Posted On2018-06-06