Incidental Mutation 'R6516:Dock4'
ID520735
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Namededicator of cytokinesis 4
SynonymsEST N28122, 6330411N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R6516 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location40445952-40846874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40731899 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 701 (V701E)
Ref Sequence ENSEMBL: ENSMUSP00000152420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: V701E

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: V701E

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220912
AA Change: V701E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40832306 missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40790068 splice site probably benign
IGL00790:Dock4 APN 12 40834391 missense probably damaging 1.00
IGL01061:Dock4 APN 12 40702969 missense probably benign 0.01
IGL01083:Dock4 APN 12 40788381 splice site probably benign
IGL01412:Dock4 APN 12 40730041 splice site probably benign
IGL01583:Dock4 APN 12 40810467 nonsense probably null
IGL01603:Dock4 APN 12 40693031 missense probably damaging 1.00
IGL01766:Dock4 APN 12 40446379 nonsense probably null
IGL02067:Dock4 APN 12 40834385 missense probably damaging 1.00
IGL02302:Dock4 APN 12 40725777 missense probably damaging 1.00
IGL02406:Dock4 APN 12 40777207 missense probably benign 0.01
IGL02547:Dock4 APN 12 40737479 missense probably benign
IGL02613:Dock4 APN 12 40810466 missense probably damaging 1.00
IGL02643:Dock4 APN 12 40668430 missense probably damaging 1.00
IGL02952:Dock4 APN 12 40710903 critical splice donor site probably null
IGL02994:Dock4 APN 12 40779160 missense probably damaging 0.99
IGL03096:Dock4 APN 12 40748001 missense probably benign 0.00
IGL03144:Dock4 APN 12 40692907 splice site probably benign
IGL03223:Dock4 APN 12 40817594 missense probably damaging 1.00
IGL03296:Dock4 APN 12 40733257 missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40733310 missense probably benign 0.42
IGL03353:Dock4 APN 12 40817758 splice site probably null
BB005:Dock4 UTSW 12 40788303 missense probably damaging 0.98
BB015:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0046:Dock4 UTSW 12 40737360 splice site probably benign
R0110:Dock4 UTSW 12 40621312 splice site probably benign
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0238:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0239:Dock4 UTSW 12 40737540 missense probably damaging 0.98
R0472:Dock4 UTSW 12 40838438 intron probably benign
R0616:Dock4 UTSW 12 40704415 missense probably benign 0.31
R0647:Dock4 UTSW 12 40710884 missense probably damaging 1.00
R0706:Dock4 UTSW 12 40702923 missense probably damaging 0.98
R0791:Dock4 UTSW 12 40704481 missense probably damaging 1.00
R0940:Dock4 UTSW 12 40631627 splice site probably benign
R1087:Dock4 UTSW 12 40729938 missense probably benign 0.40
R1180:Dock4 UTSW 12 40640414 missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40829616 missense probably damaging 1.00
R1463:Dock4 UTSW 12 40816325 frame shift probably null
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1468:Dock4 UTSW 12 40755810 missense probably benign 0.00
R1523:Dock4 UTSW 12 40693025 missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40669045 missense probably damaging 0.99
R1682:Dock4 UTSW 12 40725780 missense probably damaging 1.00
R1691:Dock4 UTSW 12 40725755 missense probably benign 0.26
R1693:Dock4 UTSW 12 40834722 missense probably benign 0.07
R1737:Dock4 UTSW 12 40807001 splice site probably null
R1802:Dock4 UTSW 12 40794598 missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40636228 missense probably damaging 1.00
R1846:Dock4 UTSW 12 40733268 missense probably benign 0.00
R1959:Dock4 UTSW 12 40710798 missense probably damaging 1.00
R1975:Dock4 UTSW 12 40779642 splice site probably benign
R1986:Dock4 UTSW 12 40730063 missense probably damaging 1.00
R2105:Dock4 UTSW 12 40692989 missense probably benign 0.00
R2134:Dock4 UTSW 12 40745668 missense probably benign
R2135:Dock4 UTSW 12 40745668 missense probably benign
R2154:Dock4 UTSW 12 40820662 missense probably damaging 1.00
R2154:Dock4 UTSW 12 40844548 small insertion probably benign
R2864:Dock4 UTSW 12 40730073 missense probably damaging 1.00
R2890:Dock4 UTSW 12 40623801 critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40731863 missense probably benign 0.02
R3808:Dock4 UTSW 12 40672810 missense probably damaging 0.99
R3811:Dock4 UTSW 12 40779124 missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40794624 critical splice donor site probably null
R3838:Dock4 UTSW 12 40794624 critical splice donor site probably null
R4091:Dock4 UTSW 12 40844267 missense probably damaging 0.99
R4735:Dock4 UTSW 12 40631526 missense probably benign 0.31
R4752:Dock4 UTSW 12 40446365 missense probably benign 0.04
R4828:Dock4 UTSW 12 40668437 missense probably damaging 1.00
R5039:Dock4 UTSW 12 40817746 missense probably damaging 1.00
R5092:Dock4 UTSW 12 40844441 missense probably benign
R5146:Dock4 UTSW 12 40649492 splice site probably null
R5213:Dock4 UTSW 12 40676742 missense probably damaging 1.00
R5214:Dock4 UTSW 12 40704466 missense probably benign 0.00
R5270:Dock4 UTSW 12 40733271 missense probably benign 0.02
R5426:Dock4 UTSW 12 40745745 missense probably damaging 1.00
R5474:Dock4 UTSW 12 40745731 missense probably benign
R5544:Dock4 UTSW 12 40834702 missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40649480 missense probably benign 0.22
R5649:Dock4 UTSW 12 40844540 missense probably benign 0.03
R5702:Dock4 UTSW 12 40737491 missense probably benign 0.02
R5846:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R5847:Dock4 UTSW 12 40621251 missense probably damaging 0.97
R5895:Dock4 UTSW 12 40755813 missense probably damaging 1.00
R5997:Dock4 UTSW 12 40755834 missense probably damaging 0.99
R6011:Dock4 UTSW 12 40817757 critical splice donor site probably null
R6022:Dock4 UTSW 12 40748110 missense probably benign 0.04
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6038:Dock4 UTSW 12 40733351 splice site probably null
R6179:Dock4 UTSW 12 40731869 missense probably benign 0.00
R6479:Dock4 UTSW 12 40828955 missense probably damaging 1.00
R6748:Dock4 UTSW 12 40704466 missense probably benign 0.44
R6752:Dock4 UTSW 12 40820617 missense probably damaging 1.00
R6814:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6864:Dock4 UTSW 12 40745746 missense probably damaging 1.00
R6872:Dock4 UTSW 12 40812326 critical splice donor site probably null
R6891:Dock4 UTSW 12 40779136 missense probably damaging 1.00
R6937:Dock4 UTSW 12 40834635 missense probably benign 0.01
R6950:Dock4 UTSW 12 40733314 missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40621286 missense probably damaging 1.00
R7129:Dock4 UTSW 12 40828879 missense probably damaging 1.00
R7140:Dock4 UTSW 12 40636159 missense probably benign 0.06
R7241:Dock4 UTSW 12 40794860 missense probably damaging 1.00
R7378:Dock4 UTSW 12 40788244 missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40725649 nonsense probably null
R7720:Dock4 UTSW 12 40806975 missense probably damaging 0.99
R7756:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7758:Dock4 UTSW 12 40710879 missense probably benign 0.02
R7759:Dock4 UTSW 12 40817736 missense probably damaging 1.00
R7787:Dock4 UTSW 12 40725677 missense probably benign
R7879:Dock4 UTSW 12 40730084 missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40788303 missense probably damaging 0.98
R8000:Dock4 UTSW 12 40833119 missense probably benign 0.05
R8042:Dock4 UTSW 12 40745760 missense probably benign 0.01
R8231:Dock4 UTSW 12 40702951 missense possibly damaging 0.88
RF018:Dock4 UTSW 12 40844399 frame shift probably null
RF025:Dock4 UTSW 12 40844393 frame shift probably null
RF063:Dock4 UTSW 12 40844399 frame shift probably null
X0028:Dock4 UTSW 12 40669047 missense probably benign 0.25
Z1176:Dock4 UTSW 12 40631614 missense probably benign 0.01
Z1176:Dock4 UTSW 12 40631616 missense probably benign 0.16
Z1177:Dock4 UTSW 12 40817641 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCTAGAGCAACCTGGCAGG -3'
(R):5'- AAGTCCCTTTCAAGTTTCATCAGC -3'

Sequencing Primer
(F):5'- TGAGACCTTACAGAGAAAGACTAGTC -3'
(R):5'- TCAAGTTTCATCAGCTCTGGAG -3'
Posted On2018-06-06