Incidental Mutation 'R6541:Il1f8'
ID520736
Institutional Source Beutler Lab
Gene Symbol Il1f8
Ensembl Gene ENSMUSG00000026985
Gene Nameinterleukin 1 family, member 8
Synonyms2310043N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24153161-24160519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24159815 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 146 (V146D)
Ref Sequence ENSEMBL: ENSMUSP00000028363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028363]
Predicted Effect probably damaging
Transcript: ENSMUST00000028363
AA Change: V146D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028363
Gene: ENSMUSG00000026985
AA Change: V146D

DomainStartEndE-ValueType
IL1 33 180 3.19e-22 SMART
Meta Mutation Damage Score 0.5259 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. Protein structure modeling indicated that this cytokine may contain a 12-stranded beta-trefoil structure that is conserved between IL1A (IL-A alpha) and IL1B (IL-1 beta). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Il1f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Il1f8 APN 2 24159913 missense probably benign 0.00
IGL01944:Il1f8 APN 2 24155279 missense probably damaging 1.00
IGL02379:Il1f8 APN 2 24154638 missense probably benign 0.01
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R0035:Il1f8 UTSW 2 24159878 missense probably benign 0.19
R2137:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R2139:Il1f8 UTSW 2 24154660 missense probably benign 0.00
R4052:Il1f8 UTSW 2 24159832 missense probably damaging 1.00
R4096:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
R4705:Il1f8 UTSW 2 24154618 missense probably benign 0.00
R5785:Il1f8 UTSW 2 24154649 missense probably benign 0.00
R7517:Il1f8 UTSW 2 24159878 missense probably benign 0.02
R7752:Il1f8 UTSW 2 24158814 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTGTTCACCCGCTGCTAAGTTG -3'
(R):5'- GAAGACATGGCATGGTGGTC -3'

Sequencing Primer
(F):5'- ACCCGCTGCTAAGTTGCTGTAG -3'
(R):5'- CTAAGAGGCTTGCTATGTTTTCAAG -3'
Posted On2018-06-06