Incidental Mutation 'R6541:Olfr1152'
ID520742
Institutional Source Beutler Lab
Gene Symbol Olfr1152
Ensembl Gene ENSMUSG00000045225
Gene Nameolfactory receptor 1152
SynonymsMOR177-12, GA_x6K02T2Q125-49372426-49373358
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87866492-87874156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87868294 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 101 (F101S)
Ref Sequence ENSEMBL: ENSMUSP00000151045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051058] [ENSMUST00000213308]
Predicted Effect probably benign
Transcript: ENSMUST00000051058
AA Change: F101S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054645
Gene: ENSMUSG00000045225
AA Change: F101S

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4e-46 PFAM
Pfam:7tm_1 40 290 1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121994
Predicted Effect probably benign
Transcript: ENSMUST00000213308
AA Change: F101S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Olfr1152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Olfr1152 APN 2 87868465 missense probably benign 0.00
IGL01618:Olfr1152 APN 2 87868144 missense probably damaging 0.96
IGL02326:Olfr1152 APN 2 87868675 missense probably damaging 1.00
IGL03162:Olfr1152 APN 2 87868140 missense probably benign 0.00
IGL03189:Olfr1152 APN 2 87868215 missense possibly damaging 0.76
I2288:Olfr1152 UTSW 2 87868135 missense probably damaging 1.00
R0761:Olfr1152 UTSW 2 87868536 missense possibly damaging 0.88
R1558:Olfr1152 UTSW 2 87868115 missense probably damaging 1.00
R1938:Olfr1152 UTSW 2 87868461 missense probably benign 0.01
R3810:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R3812:Olfr1152 UTSW 2 87868401 missense probably damaging 1.00
R4728:Olfr1152 UTSW 2 87868435 missense probably benign 0.13
R4928:Olfr1152 UTSW 2 87868230 missense probably benign 0.32
R5172:Olfr1152 UTSW 2 87868827 missense probably benign 0.20
R5174:Olfr1152 UTSW 2 87868411 missense possibly damaging 0.79
R6147:Olfr1152 UTSW 2 87868717 missense probably benign 0.03
R6195:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R6233:Olfr1152 UTSW 2 87868560 missense possibly damaging 0.63
R7507:Olfr1152 UTSW 2 87868369 missense probably damaging 1.00
R8068:Olfr1152 UTSW 2 87868651 missense not run
Predicted Primers PCR Primer
(F):5'- CCAATAATCCTGTGATCAAGGTG -3'
(R):5'- CAGCATCTACAATGGCAACTG -3'

Sequencing Primer
(F):5'- GTGATCAAGGTGATTTTATTTACCAC -3'
(R):5'- TGGCAACTGTGTAAACTACAGC -3'
Posted On2018-06-06