Incidental Mutation 'R6516:C7'
ID520743
Institutional Source Beutler Lab
Gene Symbol C7
Ensembl Gene ENSMUSG00000079105
Gene Namecomplement component 7
SynonymsLOC383055
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6516 (G1)
Quality Score151.008
Status Validated
Chromosome15
Chromosomal Location4988762-5063740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5057081 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 26 (V26A)
Ref Sequence ENSEMBL: ENSMUSP00000106317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110689]
Predicted Effect probably damaging
Transcript: ENSMUST00000110689
AA Change: V26A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: V26A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 30 80 1.95e-7 SMART
LDLa 84 121 6.53e-9 SMART
MACPF 248 450 9.45e-51 SMART
TSP1 503 551 1.62e-4 SMART
CCP 571 626 1.84e-9 SMART
CCP 631 688 2.23e-8 SMART
FIMAC 699 766 1.63e-24 SMART
FIMAC 773 841 4.65e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in C7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:C7 APN 15 5059389 splice site probably benign
IGL02803:C7 APN 15 5049560 missense probably damaging 1.00
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0271:C7 UTSW 15 5015380 missense possibly damaging 0.81
R0360:C7 UTSW 15 4988962 missense probably benign 0.00
R0433:C7 UTSW 15 4988916 missense probably damaging 1.00
R0505:C7 UTSW 15 4994142 splice site probably benign
R1056:C7 UTSW 15 5045778 missense possibly damaging 0.89
R1443:C7 UTSW 15 5059419 missense probably benign 0.01
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1700:C7 UTSW 15 5002792 nonsense probably null
R1774:C7 UTSW 15 5012075 missense probably damaging 0.99
R1801:C7 UTSW 15 5012021 missense possibly damaging 0.61
R1809:C7 UTSW 15 5034339 missense probably damaging 0.99
R1986:C7 UTSW 15 5012012 missense possibly damaging 0.94
R2037:C7 UTSW 15 5034238 nonsense probably null
R2047:C7 UTSW 15 5045661 missense probably damaging 1.00
R2073:C7 UTSW 15 4990428 missense probably benign 0.09
R3972:C7 UTSW 15 5007651 missense possibly damaging 0.77
R4080:C7 UTSW 15 4990464 missense probably benign 0.09
R4200:C7 UTSW 15 4990309 critical splice donor site probably null
R4576:C7 UTSW 15 5002756 missense probably damaging 1.00
R4815:C7 UTSW 15 5059405 missense probably benign 0.16
R4995:C7 UTSW 15 5049592 missense probably damaging 1.00
R5300:C7 UTSW 15 5031950 missense probably damaging 1.00
R5562:C7 UTSW 15 5031915 nonsense probably null
R5708:C7 UTSW 15 5015401 missense possibly damaging 0.90
R5740:C7 UTSW 15 5057040 missense probably benign 0.00
R5873:C7 UTSW 15 5005235 missense probably damaging 1.00
R6222:C7 UTSW 15 5011941 missense possibly damaging 0.89
R6810:C7 UTSW 15 5007654 missense probably damaging 0.98
R7019:C7 UTSW 15 5045682 missense probably benign 0.04
R7199:C7 UTSW 15 4994243 missense probably benign 0.09
R7276:C7 UTSW 15 5011967 missense probably damaging 1.00
R7422:C7 UTSW 15 5012056 missense probably benign 0.13
R7652:C7 UTSW 15 5012105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACAAGTCCTGGTTTCTTCCTTG -3'
(R):5'- TCATCAATAGTCAACAGCTTACCTC -3'

Sequencing Primer
(F):5'- GTCCTGGTTTCTTCCTTGAAAATTAC -3'
(R):5'- CAAACTTGTGTAGCTGAGCATGACC -3'
Posted On2018-06-06