Incidental Mutation 'R6541:Esf1'
ID 520746
Institutional Source Beutler Lab
Gene Symbol Esf1
Ensembl Gene ENSMUSG00000045624
Gene Name ESF1 nucleolar pre-rRNA processing protein homolog
Synonyms 2610101J03Rik
MMRRC Submission 044667-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R6541 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 139961803-140012484 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140009799 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000036523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044825] [ENSMUST00000046030]
AlphaFold Q3V1V3
Predicted Effect probably benign
Transcript: ENSMUST00000044825
SMART Domains Protein: ENSMUSP00000035325
Gene: ENSMUSG00000027384

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Methyltransf_29 45 196 7.1e-8 PFAM
Pfam:Methyltransf_23 53 239 6.4e-16 PFAM
Pfam:Ubie_methyltran 78 204 3e-10 PFAM
Pfam:Methyltransf_18 89 187 1.1e-8 PFAM
Pfam:Methyltransf_31 92 243 9.6e-13 PFAM
Pfam:Methyltransf_25 93 182 1.3e-9 PFAM
Pfam:Methyltransf_12 94 184 2.4e-14 PFAM
Pfam:Methyltransf_11 94 186 6.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046030
AA Change: V179A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624
AA Change: V179A

DomainStartEndE-ValueType
coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125913
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ass1 T C 2: 31,400,245 (GRCm39) V321A probably damaging Het
BC028528 T A 3: 95,795,530 (GRCm39) M91L probably benign Het
Bicra T C 7: 15,713,054 (GRCm39) T998A probably benign Het
Cdkl3 T G 11: 51,913,571 (GRCm39) L220R probably damaging Het
Cluh A G 11: 74,548,040 (GRCm39) D117G probably damaging Het
Cplane1 T C 15: 8,248,779 (GRCm39) V1776A possibly damaging Het
Crygf T C 1: 65,967,224 (GRCm39) F116S probably damaging Het
Ergic2 T A 6: 148,084,648 (GRCm39) Y20F probably damaging Het
Gm28360 T C 1: 117,758,047 (GRCm39) probably benign Het
Hhatl C T 9: 121,614,210 (GRCm39) V385I probably damaging Het
Iba57 A T 11: 59,049,689 (GRCm39) D219E possibly damaging Het
Il36b T A 2: 24,049,827 (GRCm39) V146D probably damaging Het
Itgal T A 7: 126,910,734 (GRCm39) V176E probably damaging Het
Kdm3a T C 6: 71,571,517 (GRCm39) M1060V possibly damaging Het
Kif18b T C 11: 102,805,092 (GRCm39) K351R probably damaging Het
Mroh9 A G 1: 162,885,607 (GRCm39) F342L possibly damaging Het
Ndufa11 T A 17: 57,024,867 (GRCm39) S10T probably benign Het
Or2bd2 A T 7: 6,443,492 (GRCm39) N198Y probably benign Het
Or5w19 T C 2: 87,698,638 (GRCm39) F101S probably benign Het
Or6b6 A T 7: 106,571,410 (GRCm39) F47Y probably benign Het
Or7h8 T A 9: 20,123,695 (GRCm39) F17I probably benign Het
Pacsin3 A G 2: 91,093,129 (GRCm39) E207G probably damaging Het
Pcsk1 T A 13: 75,274,103 (GRCm39) L136Q probably damaging Het
Prr18 G T 17: 8,560,168 (GRCm39) R108L possibly damaging Het
Rdh5 A G 10: 128,753,977 (GRCm39) V44A possibly damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Sh2d4b T C 14: 40,542,748 (GRCm39) T343A probably benign Het
Slc16a10 T C 10: 39,913,268 (GRCm39) N480S probably benign Het
Spaca7b T A 8: 11,712,613 (GRCm39) Q79L probably benign Het
Sval3 A T 6: 41,949,380 (GRCm39) N73Y probably damaging Het
Taar7d T C 10: 23,904,129 (GRCm39) I337T probably benign Het
Ttn T A 2: 76,577,039 (GRCm39) Q24618L possibly damaging Het
Ugt1a9 T A 1: 87,999,318 (GRCm39) V256E probably damaging Het
Vmn2r108 T A 17: 20,701,480 (GRCm39) I7F probably benign Het
Vmn2r55 A G 7: 12,404,939 (GRCm39) S155P probably damaging Het
Vwa3b T A 1: 37,090,842 (GRCm39) V169E probably damaging Het
Other mutations in Esf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Esf1 APN 2 140,009,737 (GRCm39) missense probably benign 0.09
IGL01075:Esf1 APN 2 139,962,665 (GRCm39) missense probably benign 0.01
IGL01777:Esf1 APN 2 139,999,092 (GRCm39) splice site probably null
IGL01863:Esf1 APN 2 139,962,599 (GRCm39) missense probably benign 0.00
IGL01982:Esf1 APN 2 140,006,448 (GRCm39) missense probably benign 0.00
IGL02040:Esf1 APN 2 139,971,181 (GRCm39) missense possibly damaging 0.70
IGL02063:Esf1 APN 2 140,006,377 (GRCm39) missense possibly damaging 0.88
IGL03063:Esf1 APN 2 139,996,706 (GRCm39) unclassified probably benign
PIT4418001:Esf1 UTSW 2 140,001,697 (GRCm39) missense probably benign 0.18
R0255:Esf1 UTSW 2 139,990,843 (GRCm39) unclassified probably benign
R0388:Esf1 UTSW 2 139,962,791 (GRCm39) missense possibly damaging 0.71
R0564:Esf1 UTSW 2 140,000,506 (GRCm39) missense possibly damaging 0.86
R0655:Esf1 UTSW 2 139,990,799 (GRCm39) missense probably benign 0.25
R0831:Esf1 UTSW 2 140,010,279 (GRCm39) missense probably damaging 1.00
R1642:Esf1 UTSW 2 140,000,406 (GRCm39) missense possibly damaging 0.85
R1984:Esf1 UTSW 2 139,990,806 (GRCm39) missense possibly damaging 0.83
R3981:Esf1 UTSW 2 140,000,476 (GRCm39) missense probably benign 0.40
R4736:Esf1 UTSW 2 139,966,891 (GRCm39) missense probably damaging 0.98
R5083:Esf1 UTSW 2 139,998,991 (GRCm39) missense possibly damaging 0.93
R5083:Esf1 UTSW 2 140,000,499 (GRCm39) missense possibly damaging 0.96
R5222:Esf1 UTSW 2 140,000,503 (GRCm39) missense possibly damaging 0.86
R5347:Esf1 UTSW 2 139,996,801 (GRCm39) nonsense probably null
R5654:Esf1 UTSW 2 140,006,148 (GRCm39) missense possibly damaging 0.85
R6123:Esf1 UTSW 2 140,010,309 (GRCm39) missense probably benign 0.01
R6132:Esf1 UTSW 2 140,001,699 (GRCm39) missense probably benign 0.18
R6299:Esf1 UTSW 2 139,965,554 (GRCm39) missense possibly damaging 0.53
R6484:Esf1 UTSW 2 140,000,458 (GRCm39) missense probably benign 0.03
R6674:Esf1 UTSW 2 139,962,726 (GRCm39) nonsense probably null
R7203:Esf1 UTSW 2 140,006,139 (GRCm39) missense possibly damaging 0.53
R7309:Esf1 UTSW 2 139,967,011 (GRCm39) splice site probably null
R7379:Esf1 UTSW 2 139,996,854 (GRCm39) missense probably benign 0.33
R8131:Esf1 UTSW 2 139,990,751 (GRCm39) nonsense probably null
R8270:Esf1 UTSW 2 139,997,033 (GRCm39) unclassified probably benign
R9066:Esf1 UTSW 2 139,990,693 (GRCm39) missense probably benign 0.02
R9186:Esf1 UTSW 2 139,990,792 (GRCm39) missense possibly damaging 0.96
R9618:Esf1 UTSW 2 140,001,714 (GRCm39) missense probably benign 0.03
R9688:Esf1 UTSW 2 140,010,095 (GRCm39) missense probably damaging 0.97
RF006:Esf1 UTSW 2 140,006,294 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AATCGTTCACCCAACTCTCATG -3'
(R):5'- GCAAAGTCAATTGAAAAGCCGATTG -3'

Sequencing Primer
(F):5'- TGTCTTTTGGTATCAAAACAGGAG -3'
(R):5'- TCAATTGAAAAGCCGATTGAAGAG -3'
Posted On 2018-06-06