Incidental Mutation 'R6541:Esf1'
ID520746
Institutional Source Beutler Lab
Gene Symbol Esf1
Ensembl Gene ENSMUSG00000045624
Gene NameESF1 nucleolar pre-rRNA processing protein homolog
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location140119883-140170564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140167879 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000036523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044825] [ENSMUST00000046030]
Predicted Effect probably benign
Transcript: ENSMUST00000044825
SMART Domains Protein: ENSMUSP00000035325
Gene: ENSMUSG00000027384

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Methyltransf_29 45 196 7.1e-8 PFAM
Pfam:Methyltransf_23 53 239 6.4e-16 PFAM
Pfam:Ubie_methyltran 78 204 3e-10 PFAM
Pfam:Methyltransf_18 89 187 1.1e-8 PFAM
Pfam:Methyltransf_31 92 243 9.6e-13 PFAM
Pfam:Methyltransf_25 93 182 1.3e-9 PFAM
Pfam:Methyltransf_12 94 184 2.4e-14 PFAM
Pfam:Methyltransf_11 94 186 6.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046030
AA Change: V179A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036523
Gene: ENSMUSG00000045624
AA Change: V179A

DomainStartEndE-ValueType
coiled coil region 91 114 N/A INTRINSIC
low complexity region 192 207 N/A INTRINSIC
low complexity region 230 258 N/A INTRINSIC
coiled coil region 261 293 N/A INTRINSIC
low complexity region 539 552 N/A INTRINSIC
coiled coil region 628 652 N/A INTRINSIC
low complexity region 667 692 N/A INTRINSIC
low complexity region 730 740 N/A INTRINSIC
Pfam:NUC153 753 781 4.1e-15 PFAM
low complexity region 784 798 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125913
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Esf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Esf1 APN 2 140167817 missense probably benign 0.09
IGL01075:Esf1 APN 2 140120745 missense probably benign 0.01
IGL01777:Esf1 APN 2 140157172 splice site probably null
IGL01863:Esf1 APN 2 140120679 missense probably benign 0.00
IGL01982:Esf1 APN 2 140164528 missense probably benign 0.00
IGL02040:Esf1 APN 2 140129261 missense possibly damaging 0.70
IGL02063:Esf1 APN 2 140164457 missense possibly damaging 0.88
IGL03063:Esf1 APN 2 140154786 unclassified probably benign
PIT4418001:Esf1 UTSW 2 140159777 missense probably benign 0.18
R0255:Esf1 UTSW 2 140148923 unclassified probably benign
R0388:Esf1 UTSW 2 140120871 missense possibly damaging 0.71
R0564:Esf1 UTSW 2 140158586 missense possibly damaging 0.86
R0655:Esf1 UTSW 2 140148879 missense probably benign 0.25
R0831:Esf1 UTSW 2 140168359 missense probably damaging 1.00
R1642:Esf1 UTSW 2 140158486 missense possibly damaging 0.85
R1984:Esf1 UTSW 2 140148886 missense possibly damaging 0.83
R3981:Esf1 UTSW 2 140158556 missense probably benign 0.40
R4736:Esf1 UTSW 2 140124971 missense probably damaging 0.98
R5083:Esf1 UTSW 2 140157071 missense possibly damaging 0.93
R5083:Esf1 UTSW 2 140158579 missense possibly damaging 0.96
R5222:Esf1 UTSW 2 140158583 missense possibly damaging 0.86
R5347:Esf1 UTSW 2 140154881 nonsense probably null
R5654:Esf1 UTSW 2 140164228 missense possibly damaging 0.85
R6123:Esf1 UTSW 2 140168389 missense probably benign 0.01
R6132:Esf1 UTSW 2 140159779 missense probably benign 0.18
R6299:Esf1 UTSW 2 140123634 missense possibly damaging 0.53
R6484:Esf1 UTSW 2 140158538 missense probably benign 0.03
R6674:Esf1 UTSW 2 140120806 nonsense probably null
R7203:Esf1 UTSW 2 140164219 missense possibly damaging 0.53
R7309:Esf1 UTSW 2 140125091 intron probably null
R7379:Esf1 UTSW 2 140154934 missense probably benign 0.33
RF006:Esf1 UTSW 2 140164374 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AATCGTTCACCCAACTCTCATG -3'
(R):5'- GCAAAGTCAATTGAAAAGCCGATTG -3'

Sequencing Primer
(F):5'- TGTCTTTTGGTATCAAAACAGGAG -3'
(R):5'- TCAATTGAAAAGCCGATTGAAGAG -3'
Posted On2018-06-06