Incidental Mutation 'R6516:Mchr1'
ID520749
Institutional Source Beutler Lab
Gene Symbol Mchr1
Ensembl Gene ENSMUSG00000050164
Gene Namemelanin-concentrating hormone receptor 1
Synonymsmelanin-concentrating hormone receptor 1, Gpr24-9, Gpr24, Mch1r, MCH-1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6516 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location81235499-81238964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81237868 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 273 (Y273C)
Ref Sequence ENSEMBL: ENSMUSP00000126191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166855]
Predicted Effect probably damaging
Transcript: ENSMUST00000166855
AA Change: Y273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126191
Gene: ENSMUSG00000050164
AA Change: Y273C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 184 4e-6 PFAM
Pfam:7TM_GPCR_Srsx 51 325 3.6e-10 PFAM
Pfam:7tm_1 57 311 2.4e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230860
Meta Mutation Damage Score 0.7303 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for some alleles may display osteoporosis, resistance to diet-induced obesity, abnormal pyramidal neuron physiology, hyperactivity, polyphagia, increased heart rate and body temperature, sleep behavior, and impaired conditioned learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Mchr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01834:Mchr1 APN 15 81237865 missense probably damaging 1.00
IGL02364:Mchr1 APN 15 81237279 missense probably benign 0.36
Ketogenic UTSW 15 81237868 missense probably damaging 1.00
PIT4366001:Mchr1 UTSW 15 81237216 missense probably benign 0.01
R0412:Mchr1 UTSW 15 81235747 start gained probably benign
R1554:Mchr1 UTSW 15 81235820 missense probably benign 0.02
R1706:Mchr1 UTSW 15 81237163 missense probably damaging 0.99
R1771:Mchr1 UTSW 15 81237235 missense probably damaging 1.00
R5522:Mchr1 UTSW 15 81238010 missense possibly damaging 0.64
R5930:Mchr1 UTSW 15 81237843 missense probably damaging 1.00
R6612:Mchr1 UTSW 15 81237870 missense probably damaging 0.99
R6978:Mchr1 UTSW 15 81237796 missense possibly damaging 0.90
R7583:Mchr1 UTSW 15 81237441 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACTCCTGTGTGGCTCTATGC -3'
(R):5'- TCTGAGCATTGCTGACCGTG -3'

Sequencing Primer
(F):5'- ACCCAGATACTGATCTTTACTGG -3'
(R):5'- ATTGCTGACCGTGCGAAG -3'
Posted On2018-06-06