Incidental Mutation 'R6516:Arhgap31'
ID520751
Institutional Source Beutler Lab
Gene Symbol Arhgap31
Ensembl Gene ENSMUSG00000022799
Gene NameRho GTPase activating protein 31
SynonymsCdGAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R6516 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38598340-38713274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38609404 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 370 (F370L)
Ref Sequence ENSEMBL: ENSMUSP00000023487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023487]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023487
AA Change: F370L

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023487
Gene: ENSMUSG00000022799
AA Change: F370L

DomainStartEndE-ValueType
RhoGAP 32 213 1.04e-60 SMART
low complexity region 291 303 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 722 733 N/A INTRINSIC
low complexity region 766 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Deup1 A C 9: 15,610,614 M85R probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Arhgap31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Arhgap31 APN 16 38603001 missense probably damaging 1.00
IGL01062:Arhgap31 APN 16 38601456 missense probably damaging 1.00
IGL01152:Arhgap31 APN 16 38602239 missense possibly damaging 0.49
IGL01680:Arhgap31 APN 16 38603614 missense probably benign 0.04
IGL01739:Arhgap31 APN 16 38603431 missense probably benign
IGL01870:Arhgap31 APN 16 38618242 missense probably damaging 1.00
IGL01936:Arhgap31 APN 16 38602925 missense probably damaging 1.00
IGL01981:Arhgap31 APN 16 38601573 missense probably damaging 1.00
IGL01983:Arhgap31 APN 16 38601765 missense probably damaging 1.00
IGL02157:Arhgap31 APN 16 38623901 missense probably damaging 1.00
IGL02629:Arhgap31 APN 16 38609164 missense probably benign 0.00
IGL03375:Arhgap31 APN 16 38602828 missense probably damaging 1.00
PIT4283001:Arhgap31 UTSW 16 38608992 missense probably damaging 1.00
R0271:Arhgap31 UTSW 16 38602510 missense possibly damaging 0.61
R1325:Arhgap31 UTSW 16 38602942 missense probably benign 0.00
R1753:Arhgap31 UTSW 16 38601612 missense possibly damaging 0.92
R1766:Arhgap31 UTSW 16 38625590 missense probably damaging 1.00
R1834:Arhgap31 UTSW 16 38603703 missense probably benign 0.02
R2104:Arhgap31 UTSW 16 38625579 missense probably benign 0.03
R2261:Arhgap31 UTSW 16 38609277 missense probably damaging 1.00
R3011:Arhgap31 UTSW 16 38601907 missense possibly damaging 0.58
R3712:Arhgap31 UTSW 16 38602533 missense possibly damaging 0.91
R3757:Arhgap31 UTSW 16 38637000 missense probably damaging 1.00
R3953:Arhgap31 UTSW 16 38603464 missense probably benign 0.00
R4105:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4107:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4108:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4109:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4198:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4200:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4273:Arhgap31 UTSW 16 38602335 missense possibly damaging 0.92
R5020:Arhgap31 UTSW 16 38603076 missense probably damaging 1.00
R5100:Arhgap31 UTSW 16 38601459 missense probably damaging 1.00
R6879:Arhgap31 UTSW 16 38602314 missense probably benign
R7341:Arhgap31 UTSW 16 38712514 intron probably null
R7880:Arhgap31 UTSW 16 38602725 missense probably benign 0.37
R7884:Arhgap31 UTSW 16 38602231 missense probably damaging 0.97
R7963:Arhgap31 UTSW 16 38602725 missense probably benign 0.37
R7967:Arhgap31 UTSW 16 38602231 missense probably damaging 0.97
R8156:Arhgap31 UTSW 16 38625629 missense probably damaging 1.00
X0063:Arhgap31 UTSW 16 38602398 missense probably damaging 0.99
Z1176:Arhgap31 UTSW 16 38623893 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACATCCCGAGAAGCTTTGGG -3'
(R):5'- CCTTGGTGGGCAATTGCTAG -3'

Sequencing Primer
(F):5'- TCTCAGGGTCTCCGATGG -3'
(R):5'- GTGGGCAATTGCTAGTATCTCTTCC -3'
Posted On2018-06-06