Incidental Mutation 'R6541:Ergic2'
ID520754
Institutional Source Beutler Lab
Gene Symbol Ergic2
Ensembl Gene ENSMUSG00000030304
Gene NameERGIC and golgi 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location148179079-148212374 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 148183150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 20 (Y20F)
Ref Sequence ENSEMBL: ENSMUSP00000144886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032446] [ENSMUST00000111607] [ENSMUST00000136008] [ENSMUST00000143282] [ENSMUST00000204832]
Predicted Effect probably benign
Transcript: ENSMUST00000032446
Predicted Effect probably benign
Transcript: ENSMUST00000111607
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126773
Predicted Effect probably damaging
Transcript: ENSMUST00000136008
AA Change: Y295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120456
Gene: ENSMUSG00000030304
AA Change: Y295F

DomainStartEndE-ValueType
Pfam:ERGIC_N 13 101 1.6e-26 PFAM
Pfam:COPIIcoated_ERV 157 333 4.8e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140311
Predicted Effect probably damaging
Transcript: ENSMUST00000143282
AA Change: Y51F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145143
Gene: ENSMUSG00000030304
AA Change: Y51F

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 1 89 2.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149631
Predicted Effect unknown
Transcript: ENSMUST00000203268
AA Change: Y115F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203993
Predicted Effect probably damaging
Transcript: ENSMUST00000204832
AA Change: Y20F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.5242 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERGIC2, or PTX1, is a ubiquitously expressed nuclear protein that is downregulated in prostate carcinoma (Kwok et al., 2001 [PubMed 11445006]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for an ENU-induced point mutation affecting the donor splice site of intron 5 exhibit swelling of the hind feet and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Ergic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Ergic2 APN 6 148195271 missense probably benign
IGL02191:Ergic2 APN 6 148204821 missense probably null 0.12
IGL02719:Ergic2 APN 6 148204819 missense possibly damaging 0.82
IGL02958:Ergic2 APN 6 148181943 makesense probably null
R0389:Ergic2 UTSW 6 148183202 missense probably benign 0.40
R0416:Ergic2 UTSW 6 148183144 missense probably damaging 1.00
R0727:Ergic2 UTSW 6 148199400 unclassified probably benign
R1835:Ergic2 UTSW 6 148189581 missense possibly damaging 0.61
R1891:Ergic2 UTSW 6 148183079 missense probably damaging 0.99
R1959:Ergic2 UTSW 6 148199354 critical splice donor site probably null
R2504:Ergic2 UTSW 6 148204774 critical splice donor site probably null
R3414:Ergic2 UTSW 6 148206681 splice site probably benign
R3732:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3732:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3733:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R3734:Ergic2 UTSW 6 148202522 missense probably damaging 1.00
R5002:Ergic2 UTSW 6 148184158 missense probably benign 0.00
R5083:Ergic2 UTSW 6 148196014 missense probably benign 0.00
R5088:Ergic2 UTSW 6 148183123 missense probably damaging 1.00
R5850:Ergic2 UTSW 6 148183107 missense possibly damaging 0.93
R6652:Ergic2 UTSW 6 148189581 missense probably damaging 1.00
R7073:Ergic2 UTSW 6 148195209 missense probably damaging 1.00
R7167:Ergic2 UTSW 6 148206635 missense probably damaging 1.00
R7275:Ergic2 UTSW 6 148195259 missense probably damaging 1.00
R7299:Ergic2 UTSW 6 148188112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCAGTGAGATCTACACAG -3'
(R):5'- AGCGATAACCCTGGTAGTTGTC -3'

Sequencing Primer
(F):5'- GTGAGATCTACACAGTAAGACCTTAC -3'
(R):5'- CCAAAGAGCTTCTGTATGGTCCAG -3'
Posted On2018-06-06