Incidental Mutation 'R6541:Vmn2r55'
ID520758
Institutional Source Beutler Lab
Gene Symbol Vmn2r55
Ensembl Gene ENSMUSG00000091045
Gene Namevomeronasal 2, receptor 55
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12651706-12684991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12671012 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 155 (S155P)
Ref Sequence ENSEMBL: ENSMUSP00000133483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167771] [ENSMUST00000172743]
Predicted Effect probably damaging
Transcript: ENSMUST00000167771
AA Change: S155P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132834
Gene: ENSMUSG00000091045
AA Change: S155P

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 398 6.1e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172743
AA Change: S155P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133483
Gene: ENSMUSG00000091045
AA Change: S155P

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.4e-57 PFAM
Pfam:7tm_3 525 762 3.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r108 T A 17: 20,481,218 I7F probably benign Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Vmn2r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Vmn2r55 APN 7 12670960 missense probably damaging 1.00
IGL03035:Vmn2r55 APN 7 12670816 missense probably benign 0.01
IGL03115:Vmn2r55 APN 7 12670631 missense probably damaging 1.00
IGL03251:Vmn2r55 APN 7 12671193 splice site probably benign
R0140:Vmn2r55 UTSW 7 12668177 missense possibly damaging 0.58
R0511:Vmn2r55 UTSW 7 12671018 missense possibly damaging 0.88
R1281:Vmn2r55 UTSW 7 12670898 missense probably benign 0.02
R1564:Vmn2r55 UTSW 7 12684751 missense probably damaging 1.00
R1602:Vmn2r55 UTSW 7 12652644 missense probably damaging 1.00
R1785:Vmn2r55 UTSW 7 12668184 missense probably damaging 0.98
R2939:Vmn2r55 UTSW 7 12651905 missense probably damaging 1.00
R2993:Vmn2r55 UTSW 7 12684955 missense probably damaging 1.00
R3151:Vmn2r55 UTSW 7 12670707 missense probably benign 0.06
R4272:Vmn2r55 UTSW 7 12668179 missense probably benign 0.38
R4589:Vmn2r55 UTSW 7 12670895 missense probably damaging 0.99
R4624:Vmn2r55 UTSW 7 12670700 missense possibly damaging 0.83
R4965:Vmn2r55 UTSW 7 12670551 missense possibly damaging 0.91
R5294:Vmn2r55 UTSW 7 12651864 missense probably damaging 1.00
R5364:Vmn2r55 UTSW 7 12670903 missense possibly damaging 0.51
R5395:Vmn2r55 UTSW 7 12651947 missense probably damaging 1.00
R5401:Vmn2r55 UTSW 7 12651944 missense probably benign
R5701:Vmn2r55 UTSW 7 12670565 missense probably benign 0.00
R5771:Vmn2r55 UTSW 7 12671032 missense probably damaging 1.00
R5846:Vmn2r55 UTSW 7 12670565 missense probably benign 0.05
R6148:Vmn2r55 UTSW 7 12668142 missense probably benign 0.01
R6159:Vmn2r55 UTSW 7 12651771 missense probably damaging 1.00
R7286:Vmn2r55 UTSW 7 12652073 missense probably damaging 0.99
R7483:Vmn2r55 UTSW 7 12670828 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACCCAGTAAGCCATGTAGG -3'
(R):5'- CCGAGTCCTGGATCTCATCTAC -3'

Sequencing Primer
(F):5'- CCCAGTAAGCCATGTAGGATGAGC -3'
(R):5'- GGCTCTTCCTTGACAGGTCAG -3'
Posted On2018-06-06