Mutagenetix > Incidental Mutation

Incidental Mutation 'R6541:Bicra'

520761

Institutional Source

Beutler Lab

Gene Symbol

Bicra

Ensembl Gene

ENSMUSG00000070808

Gene Name

BRD4 interacting chromatin remodeling complex associated protein

Synonyms

Gltscr1

MMRRC Submission

044667-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R6541 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15970672-16047921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15979129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 998 (T998A)

Ref Sequence

ENSEMBL: ENSMUSP00000148012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]

AlphaFold

F8VPZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000094821
AA Change: T998A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: T998A

Domain	Start	End	E-Value	Type
low complexity region	86	96	N/A	INTRINSIC
low complexity region	140	155	N/A	INTRINSIC
internal_repeat_1	156	298	1.03e-6	PROSPERO
low complexity region	308	323	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
internal_repeat_1	479	614	1.03e-6	PROSPERO
low complexity region	619	638	N/A	INTRINSIC
low complexity region	642	676	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	756	782	N/A	INTRINSIC
low complexity region	790	819	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	852	906	N/A	INTRINSIC
low complexity region	940	950	N/A	INTRINSIC
low complexity region	987	1006	N/A	INTRINSIC
Pfam:GLTSCR1	1094	1202	4.6e-43	PFAM
low complexity region	1232	1251	N/A	INTRINSIC
low complexity region	1275	1294	N/A	INTRINSIC
low complexity region	1349	1371	N/A	INTRINSIC
low complexity region	1460	1473	N/A	INTRINSIC
low complexity region	1535	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210713

Predicted Effect

probably benign
Transcript: ENSMUST00000210781
AA Change: T998A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

97% (36/37)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016D06Rik	T	A	8: 11,662,613	Q79L	probably benign	Het
2410089E03Rik	T	C	15: 8,219,295	V1776A	possibly damaging	Het
Ass1	T	C	2: 31,510,233	V321A	probably damaging	Het
BC028528	T	A	3: 95,888,218	M91L	probably benign	Het
Cdkl3	T	G	11: 52,022,744	L220R	probably damaging	Het
Cluh	A	G	11: 74,657,214	D117G	probably damaging	Het
Crygf	T	C	1: 65,928,065	F116S	probably damaging	Het
Ergic2	T	A	6: 148,183,150	Y20F	probably damaging	Het
Esf1	A	G	2: 140,167,879	V179A	probably benign	Het
Gm28360	T	C	1: 117,830,317		probably benign	Het
Hhatl	C	T	9: 121,785,144	V385I	probably damaging	Het
Iba57	A	T	11: 59,158,863	D219E	possibly damaging	Het
Il1f8	T	A	2: 24,159,815	V146D	probably damaging	Het
Itgal	T	A	7: 127,311,562	V176E	probably damaging	Het
Kdm3a	T	C	6: 71,594,533	M1060V	possibly damaging	Het
Kif18b	T	C	11: 102,914,266	K351R	probably damaging	Het
Mroh9	A	G	1: 163,058,038	F342L	possibly damaging	Het
Ndufa11	T	A	17: 56,717,867	S10T	probably benign	Het
Olfr1152	T	C	2: 87,868,294	F101S	probably benign	Het
Olfr1344	A	T	7: 6,440,493	N198Y	probably benign	Het
Olfr711	A	T	7: 106,972,203	F47Y	probably benign	Het
Olfr871	T	A	9: 20,212,399	F17I	probably benign	Het
Pacsin3	A	G	2: 91,262,784	E207G	probably damaging	Het
Pcsk1	T	A	13: 75,125,984	L136Q	probably damaging	Het
Prr18	G	T	17: 8,341,336	R108L	possibly damaging	Het
Rdh5	A	G	10: 128,918,108	V44A	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Sh2d4b	T	C	14: 40,820,791	T343A	probably benign	Het
Slc16a10	T	C	10: 40,037,272	N480S	probably benign	Het
Sval3	A	T	6: 41,972,446	N73Y	probably damaging	Het
Taar7d	T	C	10: 24,028,231	I337T	probably benign	Het
Ttn	T	A	2: 76,746,695	Q24618L	possibly damaging	Het
Ugt1a9	T	A	1: 88,071,596	V256E	probably damaging	Het
Vmn2r108	T	A	17: 20,481,218	I7F	probably benign	Het
Vmn2r55	A	G	7: 12,671,012	S155P	probably damaging	Het
Vwa3b	T	A	1: 37,051,761	V169E	probably damaging	Het

Other mutations in Bicra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Bicra	APN	7	15996577	missense	possibly damaging	0.70
IGL01521:Bicra	APN	7	15989188	missense	probably benign	0.18
IGL01690:Bicra	APN	7	15987753	missense	probably benign	0.09
IGL01721:Bicra	APN	7	15988699	missense	probably benign
IGL01994:Bicra	APN	7	15972816	missense	possibly damaging	0.46
IGL02084:Bicra	APN	7	15987738	missense	probably benign	0.09
IGL02312:Bicra	APN	7	15993141	missense	possibly damaging	0.85
IGL02686:Bicra	APN	7	15987915	missense	probably benign	0.02
IGL02727:Bicra	APN	7	15979465	missense	possibly damaging	0.95
IGL03031:Bicra	APN	7	15975801	missense	probably benign	0.16
R0003:Bicra	UTSW	7	15971887	missense	probably benign
R0025:Bicra	UTSW	7	15987511	missense	possibly damaging	0.53
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0417:Bicra	UTSW	7	15972322	missense	probably damaging	1.00
R0437:Bicra	UTSW	7	15988762	missense	possibly damaging	0.73
R0547:Bicra	UTSW	7	15972248	missense	probably damaging	1.00
R0688:Bicra	UTSW	7	15989322	missense	probably damaging	1.00
R0855:Bicra	UTSW	7	15972004	missense	probably damaging	1.00
R1448:Bicra	UTSW	7	15988359	missense	possibly damaging	0.86
R1637:Bicra	UTSW	7	15972689	missense	probably benign	0.19
R1899:Bicra	UTSW	7	15987751	missense	possibly damaging	0.53
R2035:Bicra	UTSW	7	15996413	missense	possibly damaging	0.53
R2247:Bicra	UTSW	7	15989234	missense	probably benign	0.33
R2471:Bicra	UTSW	7	15972332	missense	probably benign	0.04
R2484:Bicra	UTSW	7	15988680	missense	possibly damaging	0.96
R3437:Bicra	UTSW	7	15989298	missense	possibly damaging	0.85
R3551:Bicra	UTSW	7	15979733	missense	probably benign	0.33
R4816:Bicra	UTSW	7	15988906	missense	possibly damaging	0.53
R4901:Bicra	UTSW	7	15987601	missense	possibly damaging	0.53
R5035:Bicra	UTSW	7	15979424	missense	possibly damaging	0.90
R5078:Bicra	UTSW	7	15975457	missense	probably damaging	1.00
R5094:Bicra	UTSW	7	15975371	missense	probably damaging	1.00
R5195:Bicra	UTSW	7	15979953	missense	possibly damaging	0.93
R5496:Bicra	UTSW	7	15987841	missense	probably benign	0.33
R5780:Bicra	UTSW	7	15979754	missense	possibly damaging	0.96
R6560:Bicra	UTSW	7	15989194	missense	possibly damaging	0.53
R6575:Bicra	UTSW	7	15979131	missense	probably benign	0.25
R6854:Bicra	UTSW	7	15988762	missense	probably benign	0.18
R6967:Bicra	UTSW	7	15972205	missense	probably damaging	0.97
R7283:Bicra	UTSW	7	15972500	missense	probably damaging	1.00
R7454:Bicra	UTSW	7	15972134	missense	probably benign	0.30
R7462:Bicra	UTSW	7	15979135	missense	possibly damaging	0.84
R7488:Bicra	UTSW	7	15989442	critical splice acceptor site	probably null
R7506:Bicra	UTSW	7	15988213	missense	possibly damaging	0.96
R7534:Bicra	UTSW	7	15971935	missense	probably damaging	0.98
R7915:Bicra	UTSW	7	15988522	missense	probably benign
R8063:Bicra	UTSW	7	15979044	missense	probably benign
R8147:Bicra	UTSW	7	15988470	missense	possibly damaging	0.93
R8699:Bicra	UTSW	7	15989188	missense	probably benign	0.18
R8784:Bicra	UTSW	7	15971950	missense	probably damaging	1.00
R8859:Bicra	UTSW	7	15987812	missense	possibly damaging	0.73
R8971:Bicra	UTSW	7	15987556	missense	probably benign	0.08
R9487:Bicra	UTSW	7	15971792	missense	probably damaging	0.99
R9614:Bicra	UTSW	7	15971955	missense	probably damaging	1.00
R9721:Bicra	UTSW	7	15979176	missense	probably damaging	1.00
R9777:Bicra	UTSW	7	15972062	missense	probably benign	0.09
X0064:Bicra	UTSW	7	15975775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTGGTACCAGCAGAGTAGGG -3'
(R):5'- AGGTAACCATCAGCAGCGAC -3'

Sequencing Primer
(F):5'- TACCAGCAGAGTAGGGGGACAC -3'
(R):5'- TCAGCAGCGACACCTAACTC -3'

Posted On

2018-06-06