Incidental Mutation 'R6516:Vti1a'
ID 520771
Institutional Source Beutler Lab
Gene Symbol Vti1a
Ensembl Gene ENSMUSG00000024983
Gene Name vesicle transport through interaction with t-SNAREs 1A
Synonyms 4921537J05Rik, Vti1-rp2, 1110014F16Rik, 1110018K19Rik
MMRRC Submission 044643-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6516 (G1)
Quality Score 178.009
Status Validated
Chromosome 19
Chromosomal Location 55304727-55615741 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55369390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 94 (A94V)
Ref Sequence ENSEMBL: ENSMUSP00000153629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095950] [ENSMUST00000223690] [ENSMUST00000225529]
AlphaFold O89116
Predicted Effect probably damaging
Transcript: ENSMUST00000095950
AA Change: A94V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093644
Gene: ENSMUSG00000024983
AA Change: A94V

DomainStartEndE-ValueType
Pfam:V-SNARE 12 90 7.3e-29 PFAM
t_SNARE 117 184 4.61e-10 SMART
low complexity region 193 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223690
AA Change: A94V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225392
Predicted Effect possibly damaging
Transcript: ENSMUST00000225529
AA Change: A94V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptors (SNAREs) that function in intracellular trafficking. This family member is involved in vesicular transport between endosomes and the trans-Golgi network. It is a vesicle-associated SNARE (v-SNARE) that interacts with target membrane SNAREs (t-SNAREs). Polymorphisms in this gene have been associated with binocular function, and also with susceptibility to colorectal and lung cancers. A recurrent rearrangement has been found between this gene and the transcription factor 7-like 2 (TCF7L2) gene in colorectal cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,780,235 (GRCm39) V93E probably benign Het
Adam18 A G 8: 25,164,703 (GRCm39) L4P probably damaging Het
Adcy8 A T 15: 64,571,236 (GRCm39) Y1136N probably damaging Het
Adgrl3 A G 5: 81,613,119 (GRCm39) Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 (GRCm39) R43W probably damaging Het
Ano8 G T 8: 71,934,424 (GRCm39) probably null Het
Arhgap31 A G 16: 38,429,766 (GRCm39) F370L possibly damaging Het
C7 A G 15: 5,086,563 (GRCm39) V26A probably damaging Het
Cimap1a G A 7: 140,428,718 (GRCm39) G128S probably damaging Het
Clec4a2 C A 6: 123,116,365 (GRCm39) Q153K probably damaging Het
Cyp2c67 T A 19: 39,605,873 (GRCm39) D341V probably damaging Het
Ddo T A 10: 40,507,741 (GRCm39) V46E probably damaging Het
Deup1 A C 9: 15,521,910 (GRCm39) M85R probably damaging Het
Dmxl2 A T 9: 54,323,960 (GRCm39) S1141R probably damaging Het
Dnah2 A G 11: 69,356,212 (GRCm39) F2147L probably benign Het
Dock10 T C 1: 80,518,178 (GRCm39) E1298G probably damaging Het
Dock4 T A 12: 40,781,898 (GRCm39) V701E possibly damaging Het
Dthd1 A T 5: 62,996,607 (GRCm39) K447N probably benign Het
Eno2 G T 6: 124,738,672 (GRCm39) probably null Het
Fastkd5 T A 2: 130,456,221 (GRCm39) T790S possibly damaging Het
Fer1l4 C T 2: 155,877,119 (GRCm39) V1139M probably damaging Het
Gpbp1 A T 13: 111,589,636 (GRCm39) H111Q probably benign Het
Grk3 A T 5: 113,109,415 (GRCm39) probably benign Het
Itpr3 C T 17: 27,310,344 (GRCm39) A403V probably benign Het
Kcnc2 A G 10: 112,297,905 (GRCm39) T610A probably benign Het
Kcnh1 T A 1: 192,101,089 (GRCm39) D560E possibly damaging Het
Klc4 A T 17: 46,953,181 (GRCm39) N116K probably damaging Het
Krba1 C T 6: 48,390,206 (GRCm39) Q656* probably null Het
Mchr1 A G 15: 81,122,069 (GRCm39) Y273C probably damaging Het
Myh15 T A 16: 48,957,996 (GRCm39) C938S probably benign Het
Nutm1 T C 2: 112,081,562 (GRCm39) E367G probably damaging Het
Or10a3n A T 7: 108,492,972 (GRCm39) I214K probably damaging Het
Or4e2 A T 14: 52,688,586 (GRCm39) T239S probably damaging Het
Or5w18 A T 2: 87,633,114 (GRCm39) Y127F possibly damaging Het
Or8b48 A G 9: 38,492,768 (GRCm39) N65S probably damaging Het
Pikfyve G T 1: 65,304,940 (GRCm39) M1697I probably benign Het
Plcd1 A G 9: 118,905,271 (GRCm39) S147P probably damaging Het
Plin3 G A 17: 56,593,223 (GRCm39) P113L probably damaging Het
Pum3 C A 19: 27,403,408 (GRCm39) S31I probably benign Het
Robo1 T C 16: 72,821,241 (GRCm39) V1327A probably benign Het
Rpl15-ps6 A G 15: 52,341,200 (GRCm39) noncoding transcript Het
Rpl34 G A 3: 130,522,716 (GRCm39) P50L probably benign Het
Scnn1b T C 7: 121,511,335 (GRCm39) S341P probably damaging Het
Sh3bp5 A T 14: 31,097,629 (GRCm39) M362K possibly damaging Het
Slc24a5 A G 2: 124,930,027 (GRCm39) T443A probably benign Het
Slc25a12 T C 2: 71,154,427 (GRCm39) Y81C probably damaging Het
Slc43a3 A G 2: 84,788,105 (GRCm39) T496A probably benign Het
Smap2 C T 4: 120,840,303 (GRCm39) probably null Het
Sptbn5 T A 2: 119,878,431 (GRCm39) probably benign Het
Taar5 A G 10: 23,847,564 (GRCm39) S321G possibly damaging Het
Tbx21 T C 11: 96,990,782 (GRCm39) I299V possibly damaging Het
Tcerg1 T C 18: 42,663,957 (GRCm39) probably null Het
Tenm3 G C 8: 48,870,257 (GRCm39) Q179E probably benign Het
Tmem176a T G 6: 48,821,002 (GRCm39) probably null Het
Tmem236 T C 2: 14,200,791 (GRCm39) S119P probably benign Het
Tmprss11a C T 5: 86,567,987 (GRCm39) V247M probably damaging Het
Tnks1bp1 T C 2: 84,901,071 (GRCm39) S1593P probably damaging Het
Ttc9b T A 7: 27,355,412 (GRCm39) D227E probably benign Het
Usp33 A C 3: 152,079,053 (GRCm39) Q435P probably benign Het
Wdr3 A G 3: 100,052,992 (GRCm39) Y587H probably damaging Het
Wwc1 G A 11: 35,758,129 (GRCm39) A739V probably benign Het
Zfp628 C G 7: 4,923,201 (GRCm39) Y474* probably null Het
Zfp820 A T 17: 22,038,354 (GRCm39) C325S probably damaging Het
Other mutations in Vti1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03130:Vti1a APN 19 55,380,279 (GRCm39) missense probably damaging 1.00
IGL03399:Vti1a APN 19 55,487,703 (GRCm39) missense probably benign 0.10
R2484:Vti1a UTSW 19 55,369,411 (GRCm39) missense possibly damaging 0.83
R3736:Vti1a UTSW 19 55,369,364 (GRCm39) splice site probably null
R4416:Vti1a UTSW 19 55,369,380 (GRCm39) missense probably benign 0.32
R4844:Vti1a UTSW 19 55,380,297 (GRCm39) missense probably damaging 1.00
R6902:Vti1a UTSW 19 55,487,673 (GRCm39) critical splice acceptor site probably null
R8077:Vti1a UTSW 19 55,564,917 (GRCm39) missense probably benign 0.07
R9103:Vti1a UTSW 19 55,316,865 (GRCm39) missense probably benign 0.00
R9449:Vti1a UTSW 19 55,612,278 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTTCCACTAAGCTTGTGGATTCTGG -3'
(R):5'- GAAGTTGATTAAGACTCAGCTTTGC -3'

Sequencing Primer
(F):5'- ACTAAGCTTGTGGATTCTGGAATTTG -3'
(R):5'- CAGTATCGCTTCCACATGAGTAG -3'
Posted On 2018-06-06