Incidental Mutation 'R6517:Stra6l'
ID520787
Institutional Source Beutler Lab
Gene Symbol Stra6l
Ensembl Gene ENSMUSG00000028327
Gene NameSTRA6-like
SynonymsRbpr2, 1300002K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location45848664-45887008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45879473 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 365 (H365R)
Ref Sequence ENSEMBL: ENSMUSP00000103412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030011] [ENSMUST00000107782] [ENSMUST00000107783]
Predicted Effect probably benign
Transcript: ENSMUST00000030011
AA Change: H365R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030011
Gene: ENSMUSG00000028327
AA Change: H365R

DomainStartEndE-ValueType
Pfam:RBP_receptor 13 602 8.7e-228 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107782
AA Change: H274R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103411
Gene: ENSMUSG00000028327
AA Change: H274R

DomainStartEndE-ValueType
Pfam:RBP_receptor 1 512 2.8e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107783
AA Change: H365R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103412
Gene: ENSMUSG00000028327
AA Change: H365R

DomainStartEndE-ValueType
Pfam:RBP_receptor 12 603 1e-254 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165478
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C T 14: 29,982,716 Q58* probably null Het
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Stra6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Stra6l APN 4 45864864 splice site probably null
IGL02343:Stra6l APN 4 45869588 missense probably damaging 0.99
IGL02710:Stra6l APN 4 45882728 missense possibly damaging 0.72
IGL02880:Stra6l APN 4 45885278 missense possibly damaging 0.70
IGL03034:Stra6l APN 4 45885392 missense probably benign 0.41
IGL03163:Stra6l APN 4 45881455 missense probably benign 0.03
IGL03355:Stra6l APN 4 45873689 missense probably benign 0.16
K2124:Stra6l UTSW 4 45870770 splice site probably benign
R0800:Stra6l UTSW 4 45882797 missense probably benign 0.29
R1171:Stra6l UTSW 4 45864982 missense probably benign
R1931:Stra6l UTSW 4 45882698 nonsense probably null
R1982:Stra6l UTSW 4 45867237 nonsense probably null
R2331:Stra6l UTSW 4 45858224 critical splice donor site probably null
R4691:Stra6l UTSW 4 45882851 missense probably benign 0.39
R4846:Stra6l UTSW 4 45873682 missense possibly damaging 0.76
R5175:Stra6l UTSW 4 45870860 missense probably benign 0.01
R5633:Stra6l UTSW 4 45881455 missense probably benign 0.00
R6212:Stra6l UTSW 4 45884664 missense probably benign
R6534:Stra6l UTSW 4 45860041 splice site probably null
R6584:Stra6l UTSW 4 45869635 splice site probably null
R7763:Stra6l UTSW 4 45869570 nonsense probably null
R8400:Stra6l UTSW 4 45864905 missense probably damaging 1.00
R8511:Stra6l UTSW 4 45885347 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGCATGTAGTAGCTATGGGC -3'
(R):5'- TGGCCACCTGAGAATTAAAAGG -3'

Sequencing Primer
(F):5'- GCTATGGGCTGCCTGCTAG -3'
(R):5'- TGGTCTTAGAGTAGAATGGTAGATTC -3'
Posted On2018-06-06