Incidental Mutation 'R6541:Vmn2r108'
ID520796
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6541 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20481218 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 7 (I7F)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: I7F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: I7F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik T A 8: 11,662,613 Q79L probably benign Het
2410089E03Rik T C 15: 8,219,295 V1776A possibly damaging Het
Ass1 T C 2: 31,510,233 V321A probably damaging Het
BC028528 T A 3: 95,888,218 M91L probably benign Het
Bicra T C 7: 15,979,129 T998A probably benign Het
Cdkl3 T G 11: 52,022,744 L220R probably damaging Het
Cluh A G 11: 74,657,214 D117G probably damaging Het
Crygf T C 1: 65,928,065 F116S probably damaging Het
Ergic2 T A 6: 148,183,150 Y20F probably damaging Het
Esf1 A G 2: 140,167,879 V179A probably benign Het
Gm28360 T C 1: 117,830,317 probably benign Het
Hhatl C T 9: 121,785,144 V385I probably damaging Het
Iba57 A T 11: 59,158,863 D219E possibly damaging Het
Il1f8 T A 2: 24,159,815 V146D probably damaging Het
Itgal T A 7: 127,311,562 V176E probably damaging Het
Kdm3a T C 6: 71,594,533 M1060V possibly damaging Het
Kif18b T C 11: 102,914,266 K351R probably damaging Het
Mroh9 A G 1: 163,058,038 F342L possibly damaging Het
Ndufa11 T A 17: 56,717,867 S10T probably benign Het
Olfr1152 T C 2: 87,868,294 F101S probably benign Het
Olfr1344 A T 7: 6,440,493 N198Y probably benign Het
Olfr711 A T 7: 106,972,203 F47Y probably benign Het
Olfr871 T A 9: 20,212,399 F17I probably benign Het
Pacsin3 A G 2: 91,262,784 E207G probably damaging Het
Pcsk1 T A 13: 75,125,984 L136Q probably damaging Het
Prr18 G T 17: 8,341,336 R108L possibly damaging Het
Rdh5 A G 10: 128,918,108 V44A possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sh2d4b T C 14: 40,820,791 T343A probably benign Het
Slc16a10 T C 10: 40,037,272 N480S probably benign Het
Sval3 A T 6: 41,972,446 N73Y probably damaging Het
Taar7d T C 10: 24,028,231 I337T probably benign Het
Ttn T A 2: 76,746,695 Q24618L possibly damaging Het
Ugt1a9 T A 1: 88,071,596 V256E probably damaging Het
Vmn2r55 A G 7: 12,671,012 S155P probably damaging Het
Vwa3b T A 1: 37,051,761 V169E probably damaging Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5290:Vmn2r108 UTSW 17 20471403 missense probably benign 0.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTACTTACTGGAGGTAATTGTCC -3'
(R):5'- TCACCTGTATAGAGGGCCTC -3'

Sequencing Primer
(F):5'- CACCACATCTCCTTCATGA -3'
(R):5'- CTGTATAGAGGGCCTCAGCTG -3'
Posted On2018-06-06