Incidental Mutation 'R6517:Actr8'
ID520816
Institutional Source Beutler Lab
Gene Symbol Actr8
Ensembl Gene ENSMUSG00000015971
Gene NameARP8 actin-related protein 8
Synonyms5730542K05Rik, ARP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6517 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location29978337-30006354 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 29982716 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 58 (Q58*)
Ref Sequence ENSEMBL: ENSMUSP00000153459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000224797] [ENSMUST00000225811]
Predicted Effect probably null
Transcript: ENSMUST00000016115
AA Change: Q81*
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: Q81*

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224343
Predicted Effect probably null
Transcript: ENSMUST00000224797
AA Change: Q81*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225793
Predicted Effect probably null
Transcript: ENSMUST00000225811
AA Change: Q58*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,283,104 probably null Het
Alpk3 T A 7: 81,078,579 S486T possibly damaging Het
Cep162 T A 9: 87,222,174 E553V probably damaging Het
Epha5 T C 5: 84,156,501 I370V possibly damaging Het
Ets1 A T 9: 32,752,797 probably null Het
Fbxo38 C T 18: 62,533,563 E180K probably damaging Het
Fscn1 A G 5: 142,971,986 D296G probably damaging Het
Glul A G 1: 153,908,033 I325V probably benign Het
Keg1 A G 19: 12,715,910 D99G probably benign Het
Krt1 A T 15: 101,850,267 V154D possibly damaging Het
Mdfic T A 6: 15,770,325 I110N probably damaging Het
Myo1g T C 11: 6,512,509 N541D probably damaging Het
Nos3 T A 5: 24,383,624 V1116D probably damaging Het
Olfr1098 A G 2: 86,923,097 I145T probably benign Het
Piwil2 G T 14: 70,374,336 Q954K probably benign Het
Ppm1l T C 3: 69,317,583 M6T probably damaging Het
Scn3a T A 2: 65,497,563 E861V possibly damaging Het
Senp2 C T 16: 22,026,724 T236M possibly damaging Het
Sgo2b A T 8: 63,931,494 V156D probably damaging Het
Sis T C 3: 72,907,142 Y1585C probably damaging Het
Slc22a22 A G 15: 57,250,969 S321P probably benign Het
Slu7 T A 11: 43,438,148 Y66N probably damaging Het
Stra6l A G 4: 45,879,473 H365R probably benign Het
Stt3b T C 9: 115,267,342 T246A probably benign Het
Taf1c T G 8: 119,604,247 N44T possibly damaging Het
Tcirg1 C T 19: 3,901,933 V376M probably damaging Het
Tkt A G 14: 30,549,323 D17G probably damaging Het
Tle6 G A 10: 81,591,976 H482Y probably damaging Het
Tnks1bp1 T C 2: 85,059,345 V672A probably benign Het
Zdbf2 T G 1: 63,305,520 D1019E possibly damaging Het
Zfp608 A T 18: 54,899,078 C597S possibly damaging Het
Zfp986 G C 4: 145,899,300 D177H probably benign Het
Other mutations in Actr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Actr8 APN 14 29988335 missense probably damaging 1.00
IGL01449:Actr8 APN 14 29990970 critical splice donor site probably null
IGL01577:Actr8 APN 14 29987275 missense probably benign
IGL02118:Actr8 APN 14 29982771 critical splice donor site probably null
IGL02647:Actr8 APN 14 29990890 missense probably damaging 1.00
IGL02659:Actr8 APN 14 29986341 missense probably damaging 1.00
IGL02696:Actr8 APN 14 29982671 missense probably benign 0.33
IGL03015:Actr8 APN 14 29986316 missense possibly damaging 0.81
IGL03335:Actr8 APN 14 29978557 missense probably benign
R0512:Actr8 UTSW 14 29978556 missense probably benign 0.00
R0735:Actr8 UTSW 14 29989712 missense probably benign 0.02
R0926:Actr8 UTSW 14 29987224 missense probably benign 0.02
R1443:Actr8 UTSW 14 29984099 missense possibly damaging 0.73
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1470:Actr8 UTSW 14 29986969 missense possibly damaging 0.90
R1616:Actr8 UTSW 14 29982644 missense possibly damaging 0.53
R2097:Actr8 UTSW 14 29987228 missense probably damaging 0.98
R2240:Actr8 UTSW 14 29989757 missense possibly damaging 0.94
R2570:Actr8 UTSW 14 29987282 missense probably damaging 1.00
R5122:Actr8 UTSW 14 29982715 missense possibly damaging 0.95
R5439:Actr8 UTSW 14 29986995 missense probably damaging 1.00
R5697:Actr8 UTSW 14 29991673 missense possibly damaging 0.73
R5727:Actr8 UTSW 14 29990881 missense probably benign 0.01
R5860:Actr8 UTSW 14 29986285 nonsense probably null
R5988:Actr8 UTSW 14 29993073 missense possibly damaging 0.71
R6006:Actr8 UTSW 14 29984142 critical splice donor site probably null
R6009:Actr8 UTSW 14 29978497 unclassified probably benign
R6155:Actr8 UTSW 14 29978589 critical splice donor site probably null
R6190:Actr8 UTSW 14 29991717 nonsense probably null
R6329:Actr8 UTSW 14 29993084 nonsense probably null
R6483:Actr8 UTSW 14 29978581 missense possibly damaging 0.53
R6562:Actr8 UTSW 14 29986454 splice site probably null
R7484:Actr8 UTSW 14 29992968 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29986401 missense probably damaging 1.00
Z1177:Actr8 UTSW 14 29987242 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTTGGTCACCTATCACTGTCATC -3'
(R):5'- CCTGCAACCCTCAGTGATATTAC -3'

Sequencing Primer
(F):5'- ACCTATCACTGTCATCCTAATTCACG -3'
(R):5'- TTACAGTGAGCCACCATGTG -3'
Posted On2018-06-06