Mutagenetix > Incidental Mutation

Incidental Mutation 'R6517:Actr8'

520816

Institutional Source

Beutler Lab

Gene Symbol

Actr8

Ensembl Gene

ENSMUSG00000015971

Gene Name

ARP8 actin-related protein 8

Synonyms

5730542K05Rik, ARP8

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29978337-30006354 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 29982716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 58 (Q58*)

Ref Sequence

ENSEMBL: ENSMUSP00000153459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016115] [ENSMUST00000224797] [ENSMUST00000225811]

AlphaFold

Q8R2S9

Predicted Effect

probably null
Transcript: ENSMUST00000016115
AA Change: Q81*

SMART Domains

Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971
AA Change: Q81*

Domain	Start	End	E-Value	Type
low complexity region	5	27	N/A	INTRINSIC
ACTIN	46	621	3.34e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224343

Predicted Effect

probably null
Transcript: ENSMUST00000224797
AA Change: Q81*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225793

Predicted Effect

probably null
Transcript: ENSMUST00000225811
AA Change: Q58*

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	A	C	15: 94,283,104		probably null	Het
Alpk3	T	A	7: 81,078,579	S486T	possibly damaging	Het
Cep162	T	A	9: 87,222,174	E553V	probably damaging	Het
Epha5	T	C	5: 84,156,501	I370V	possibly damaging	Het
Ets1	A	T	9: 32,752,797		probably null	Het
Fbxo38	C	T	18: 62,533,563	E180K	probably damaging	Het
Fscn1	A	G	5: 142,971,986	D296G	probably damaging	Het
Glul	A	G	1: 153,908,033	I325V	probably benign	Het
Keg1	A	G	19: 12,715,910	D99G	probably benign	Het
Krt1	A	T	15: 101,850,267	V154D	possibly damaging	Het
Mdfic	T	A	6: 15,770,325	I110N	probably damaging	Het
Myo1g	T	C	11: 6,512,509	N541D	probably damaging	Het
Nos3	T	A	5: 24,383,624	V1116D	probably damaging	Het
Olfr1098	A	G	2: 86,923,097	I145T	probably benign	Het
Piwil2	G	T	14: 70,374,336	Q954K	probably benign	Het
Ppm1l	T	C	3: 69,317,583	M6T	probably damaging	Het
Scn3a	T	A	2: 65,497,563	E861V	possibly damaging	Het
Senp2	C	T	16: 22,026,724	T236M	possibly damaging	Het
Sgo2b	A	T	8: 63,931,494	V156D	probably damaging	Het
Sis	T	C	3: 72,907,142	Y1585C	probably damaging	Het
Slc22a22	A	G	15: 57,250,969	S321P	probably benign	Het
Slu7	T	A	11: 43,438,148	Y66N	probably damaging	Het
Stra6l	A	G	4: 45,879,473	H365R	probably benign	Het
Stt3b	T	C	9: 115,267,342	T246A	probably benign	Het
Taf1c	T	G	8: 119,604,247	N44T	possibly damaging	Het
Tcirg1	C	T	19: 3,901,933	V376M	probably damaging	Het
Tkt	A	G	14: 30,549,323	D17G	probably damaging	Het
Tle6	G	A	10: 81,591,976	H482Y	probably damaging	Het
Tnks1bp1	T	C	2: 85,059,345	V672A	probably benign	Het
Zdbf2	T	G	1: 63,305,520	D1019E	possibly damaging	Het
Zfp608	A	T	18: 54,899,078	C597S	possibly damaging	Het
Zfp986	G	C	4: 145,899,300	D177H	probably benign	Het

Other mutations in Actr8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Actr8	APN	14	29988335	missense	probably damaging	1.00
IGL01449:Actr8	APN	14	29990970	critical splice donor site	probably null
IGL01577:Actr8	APN	14	29987275	missense	probably benign
IGL02118:Actr8	APN	14	29982771	critical splice donor site	probably null
IGL02647:Actr8	APN	14	29990890	missense	probably damaging	1.00
IGL02659:Actr8	APN	14	29986341	missense	probably damaging	1.00
IGL02696:Actr8	APN	14	29982671	missense	probably benign	0.33
IGL03015:Actr8	APN	14	29986316	missense	possibly damaging	0.81
IGL03335:Actr8	APN	14	29978557	missense	probably benign
R0512:Actr8	UTSW	14	29978556	missense	probably benign	0.00
R0735:Actr8	UTSW	14	29989712	missense	probably benign	0.02
R0926:Actr8	UTSW	14	29987224	missense	probably benign	0.02
R1443:Actr8	UTSW	14	29984099	missense	possibly damaging	0.73
R1470:Actr8	UTSW	14	29986969	missense	possibly damaging	0.90
R1470:Actr8	UTSW	14	29986969	missense	possibly damaging	0.90
R1616:Actr8	UTSW	14	29982644	missense	possibly damaging	0.53
R2097:Actr8	UTSW	14	29987228	missense	probably damaging	0.98
R2240:Actr8	UTSW	14	29989757	missense	possibly damaging	0.94
R2570:Actr8	UTSW	14	29987282	missense	probably damaging	1.00
R5122:Actr8	UTSW	14	29982715	missense	possibly damaging	0.95
R5439:Actr8	UTSW	14	29986995	missense	probably damaging	1.00
R5697:Actr8	UTSW	14	29991673	missense	possibly damaging	0.73
R5727:Actr8	UTSW	14	29990881	missense	probably benign	0.01
R5860:Actr8	UTSW	14	29986285	nonsense	probably null
R5988:Actr8	UTSW	14	29993073	missense	possibly damaging	0.71
R6006:Actr8	UTSW	14	29984142	critical splice donor site	probably null
R6009:Actr8	UTSW	14	29978497	unclassified	probably benign
R6155:Actr8	UTSW	14	29978589	critical splice donor site	probably null
R6190:Actr8	UTSW	14	29991717	nonsense	probably null
R6329:Actr8	UTSW	14	29993084	nonsense	probably null
R6483:Actr8	UTSW	14	29978581	missense	possibly damaging	0.53
R6562:Actr8	UTSW	14	29986454	splice site	probably null
R7484:Actr8	UTSW	14	29992968	missense	probably damaging	1.00
R8190:Actr8	UTSW	14	29984073	missense	possibly damaging	0.66
R8236:Actr8	UTSW	14	29982628	missense	probably damaging	1.00
R8516:Actr8	UTSW	14	29990899	missense	probably benign	0.17
R9484:Actr8	UTSW	14	29986344	missense	probably benign	0.19
Z1177:Actr8	UTSW	14	29986401	missense	probably damaging	1.00
Z1177:Actr8	UTSW	14	29987242	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGTTGGTCACCTATCACTGTCATC -3'
(R):5'- CCTGCAACCCTCAGTGATATTAC -3'

Sequencing Primer
(F):5'- ACCTATCACTGTCATCCTAATTCACG -3'
(R):5'- TTACAGTGAGCCACCATGTG -3'

Posted On

2018-06-06