Incidental Mutation 'R6542:Aasdh'
ID 520825
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 044668-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R6542 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 76873659-76905514 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76883055 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 566 (L566Q)
Ref Sequence ENSEMBL: ENSMUSP00000117639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570] [ENSMUST00000149602]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: L566Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: L566Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: L566Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: L566Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123059
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect probably damaging
Transcript: ENSMUST00000146570
AA Change: L566Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: L566Q

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apbb1ip C T 2: 22,874,960 (GRCm38) T551I probably benign Het
Aqp5 A G 15: 99,594,262 (GRCm38) E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 (GRCm38) F306S probably damaging Het
Clca3a1 C T 3: 144,759,260 (GRCm38) V71I probably benign Het
Cog4 A G 8: 110,851,362 (GRCm38) D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 (GRCm38) probably benign Het
Dync1li2 C T 8: 104,442,764 (GRCm38) G13D probably benign Het
F5 T C 1: 164,194,468 (GRCm38) V1504A probably benign Het
Fancm T C 12: 65,097,429 (GRCm38) L555P probably damaging Het
Fgfr2 A T 7: 130,201,123 (GRCm38) S152T probably benign Het
Fign A T 2: 63,980,295 (GRCm38) H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 (GRCm38) N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 (GRCm38) M20K probably benign Het
Isoc2b T C 7: 4,851,455 (GRCm38) K26E probably damaging Het
Katnal1 C T 5: 148,876,206 (GRCm38) A467T probably benign Het
Loxl3 A G 6: 83,048,166 (GRCm38) T292A probably benign Het
Map3k9 A G 12: 81,722,254 (GRCm38) S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 (GRCm38) V174D probably damaging Het
Metrnl A C 11: 121,702,878 (GRCm38) probably null Het
Midn A G 10: 80,156,584 (GRCm38) D490G probably damaging Het
Mmp10 G A 9: 7,506,512 (GRCm38) A330T probably benign Het
Mto1 T A 9: 78,457,228 (GRCm38) C281S possibly damaging Het
Nek10 A G 14: 14,999,108 (GRCm38) I1036V probably benign Het
Odad1 G T 7: 45,948,390 (GRCm38) A575S probably benign Het
Or13c7c A C 4: 43,835,686 (GRCm38) L268R probably benign Het
Or1ab2 T C 8: 72,109,871 (GRCm38) F102L probably damaging Het
Or2b7 T C 13: 21,555,507 (GRCm38) T172A probably damaging Het
Or8b48 C A 9: 38,539,437 (GRCm38) L181I probably benign Het
Parp4 A C 14: 56,647,882 (GRCm38) I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 (GRCm38) Y212C probably damaging Het
Pilra G T 5: 137,821,975 (GRCm38) probably null Het
Pkhd1 A G 1: 20,585,703 (GRCm38) I202T probably benign Het
Ppfia2 A T 10: 106,835,725 (GRCm38) E432D probably damaging Het
Prom1 T C 5: 44,037,509 (GRCm38) D298G possibly damaging Het
Prr22 T A 17: 56,770,527 (GRCm38) probably null Het
Septin2 T A 1: 93,497,466 (GRCm38) probably null Het
Setdb1 C A 3: 95,340,307 (GRCm38) V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 (GRCm38) A405V probably damaging Het
Srrm1 G A 4: 135,340,926 (GRCm38) R279* probably null Het
Ssh2 C G 11: 77,450,150 (GRCm38) D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 (GRCm38) D373G probably damaging Het
Trpm3 T C 19: 22,926,113 (GRCm38) L921S probably benign Het
Ubqln3 T C 7: 104,141,617 (GRCm38) N422S probably benign Het
Vmn2r105 C T 17: 20,228,541 (GRCm38) V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 (GRCm38) Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 (GRCm38) F353L probably damaging Het
Zfp462 G A 4: 55,023,433 (GRCm38) C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 (GRCm38) S320G probably damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76,878,534 (GRCm38) unclassified probably benign
IGL01013:Aasdh APN 5 76,886,206 (GRCm38) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76,888,617 (GRCm38) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76,902,114 (GRCm38) missense probably benign 0.27
IGL02614:Aasdh APN 5 76,896,368 (GRCm38) splice site probably benign
IGL02678:Aasdh APN 5 76,888,020 (GRCm38) splice site probably benign
IGL02739:Aasdh APN 5 76,878,517 (GRCm38) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76,902,110 (GRCm38) missense probably benign 0.01
IGL03116:Aasdh APN 5 76,902,089 (GRCm38) splice site probably null
IGL03398:Aasdh APN 5 76,891,719 (GRCm38) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76,896,617 (GRCm38) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76,886,235 (GRCm38) missense probably benign 0.05
R0226:Aasdh UTSW 5 76,902,002 (GRCm38) missense probably damaging 1.00
R0367:Aasdh UTSW 5 76,902,114 (GRCm38) missense probably damaging 0.99
R0386:Aasdh UTSW 5 76,896,461 (GRCm38) missense probably damaging 0.98
R0529:Aasdh UTSW 5 76,876,267 (GRCm38) nonsense probably null
R0881:Aasdh UTSW 5 76,876,283 (GRCm38) missense probably damaging 1.00
R0882:Aasdh UTSW 5 76,876,283 (GRCm38) missense probably damaging 1.00
R1033:Aasdh UTSW 5 76,876,283 (GRCm38) missense probably damaging 1.00
R1034:Aasdh UTSW 5 76,876,283 (GRCm38) missense probably damaging 1.00
R1035:Aasdh UTSW 5 76,876,283 (GRCm38) missense probably damaging 1.00
R1036:Aasdh UTSW 5 76,876,283 (GRCm38) missense probably damaging 1.00
R1366:Aasdh UTSW 5 76,888,804 (GRCm38) missense probably benign 0.10
R1446:Aasdh UTSW 5 76,886,289 (GRCm38) missense probably benign 0.45
R1449:Aasdh UTSW 5 76,886,289 (GRCm38) missense probably benign 0.45
R1469:Aasdh UTSW 5 76,891,679 (GRCm38) missense probably damaging 0.97
R1469:Aasdh UTSW 5 76,891,679 (GRCm38) missense probably damaging 0.97
R1583:Aasdh UTSW 5 76,882,681 (GRCm38) missense probably benign 0.00
R1641:Aasdh UTSW 5 76,891,779 (GRCm38) missense probably benign 0.36
R1876:Aasdh UTSW 5 76,877,549 (GRCm38) missense probably damaging 1.00
R1895:Aasdh UTSW 5 76,891,704 (GRCm38) missense probably damaging 1.00
R1946:Aasdh UTSW 5 76,891,704 (GRCm38) missense probably damaging 1.00
R3615:Aasdh UTSW 5 76,888,782 (GRCm38) missense probably benign 0.20
R3616:Aasdh UTSW 5 76,888,782 (GRCm38) missense probably benign 0.20
R3746:Aasdh UTSW 5 76,888,654 (GRCm38) nonsense probably null
R3747:Aasdh UTSW 5 76,888,654 (GRCm38) nonsense probably null
R3748:Aasdh UTSW 5 76,888,654 (GRCm38) nonsense probably null
R3750:Aasdh UTSW 5 76,888,654 (GRCm38) nonsense probably null
R3836:Aasdh UTSW 5 76,878,468 (GRCm38) missense probably benign 0.32
R4857:Aasdh UTSW 5 76,887,284 (GRCm38) missense probably benign 0.01
R4928:Aasdh UTSW 5 76,896,688 (GRCm38) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76,888,654 (GRCm38) nonsense probably null
R5762:Aasdh UTSW 5 76,896,598 (GRCm38) missense probably benign 0.00
R5866:Aasdh UTSW 5 76,876,211 (GRCm38) missense probably damaging 1.00
R5940:Aasdh UTSW 5 76,882,898 (GRCm38) missense probably benign 0.07
R6253:Aasdh UTSW 5 76,886,258 (GRCm38) missense possibly damaging 0.81
R6825:Aasdh UTSW 5 76,888,849 (GRCm38) splice site probably null
R6868:Aasdh UTSW 5 76,891,680 (GRCm38) missense probably damaging 0.99
R6876:Aasdh UTSW 5 76,896,441 (GRCm38) missense probably damaging 1.00
R6961:Aasdh UTSW 5 76,876,301 (GRCm38) missense probably damaging 1.00
R6963:Aasdh UTSW 5 76,896,456 (GRCm38) missense probably damaging 0.99
R7069:Aasdh UTSW 5 76,876,356 (GRCm38) missense probably benign 0.03
R7220:Aasdh UTSW 5 76,901,925 (GRCm38) missense probably benign 0.13
R7545:Aasdh UTSW 5 76,880,014 (GRCm38) missense probably damaging 1.00
R7673:Aasdh UTSW 5 76,882,708 (GRCm38) missense probably benign 0.03
R7703:Aasdh UTSW 5 76,888,077 (GRCm38) missense probably damaging 0.99
R7890:Aasdh UTSW 5 76,884,122 (GRCm38) missense probably benign 0.19
R7978:Aasdh UTSW 5 76,888,668 (GRCm38) missense probably damaging 0.99
R8046:Aasdh UTSW 5 76,896,478 (GRCm38) missense probably benign
R8152:Aasdh UTSW 5 76,896,458 (GRCm38) missense probably damaging 1.00
R8425:Aasdh UTSW 5 76,886,277 (GRCm38) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 76,891,794 (GRCm38) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 76,876,130 (GRCm38) missense probably damaging 1.00
R9361:Aasdh UTSW 5 76,882,378 (GRCm38) missense probably benign 0.01
R9519:Aasdh UTSW 5 76,882,725 (GRCm38) missense probably benign 0.00
Z1088:Aasdh UTSW 5 76,901,157 (GRCm38) splice site probably null
Z1176:Aasdh UTSW 5 76,891,796 (GRCm38) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTCTAAGAGGGAACTGCTG -3'
(R):5'- TTAGCAATTATACAGCGACCCC -3'

Sequencing Primer
(F):5'- GGAACTGCTGAGGATAACTTCC -3'
(R):5'- CCGTGATGACCATTAGTCTAGAG -3'
Posted On 2018-06-06