Incidental Mutation 'R6542:Katnal1'
ID520831
Institutional Source Beutler Lab
Gene Symbol Katnal1
Ensembl Gene ENSMUSG00000041298
Gene Namekatanin p60 subunit A-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6542 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location148871584-148929320 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148876206 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 467 (A467T)
Ref Sequence ENSEMBL: ENSMUSP00000043210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047257]
Predicted Effect probably benign
Transcript: ENSMUST00000047257
AA Change: A467T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043210
Gene: ENSMUSG00000041298
AA Change: A467T

DomainStartEndE-ValueType
PDB:2RPA|A 1 72 3e-19 PDB
low complexity region 100 111 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
AAA 238 380 3.01e-20 SMART
Pfam:Vps4_C 437 486 2.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139269
Meta Mutation Damage Score 0.1133 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU induced mutation display male infertility with decreased testis weight and premature exfoliation of spermatids from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,883,055 L566Q probably damaging Het
Apbb1ip C T 2: 22,874,960 T551I probably benign Het
Aqp5 A G 15: 99,594,262 E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 F306S probably damaging Het
Ccdc114 G T 7: 45,948,390 A575S probably benign Het
Clca3a1 C T 3: 144,759,260 V71I probably benign Het
Cog4 A G 8: 110,851,362 D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 probably benign Het
Dync1li2 C T 8: 104,442,764 G13D probably benign Het
F5 T C 1: 164,194,468 V1504A probably benign Het
Fancm T C 12: 65,097,429 L555P probably damaging Het
Fgfr2 A T 7: 130,201,123 S152T probably benign Het
Fign A T 2: 63,980,295 H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 M20K probably benign Het
Isoc2b T C 7: 4,851,455 K26E probably damaging Het
Loxl3 A G 6: 83,048,166 T292A probably benign Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 V174D probably damaging Het
Metrnl A C 11: 121,702,878 probably null Het
Midn A G 10: 80,156,584 D490G probably damaging Het
Mmp10 G A 9: 7,506,512 A330T probably benign Het
Mto1 T A 9: 78,457,228 C281S possibly damaging Het
Nek10 A G 14: 14,999,108 I1036V probably benign Het
Olfr1535 T C 13: 21,555,507 T172A probably damaging Het
Olfr157 A C 4: 43,835,686 L268R probably benign Het
Olfr374 T C 8: 72,109,871 F102L probably damaging Het
Olfr912 C A 9: 38,539,437 L181I probably benign Het
Parp4 A C 14: 56,647,882 I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 Y212C probably damaging Het
Pilra G T 5: 137,821,975 probably null Het
Pkhd1 A G 1: 20,585,703 I202T probably benign Het
Ppfia2 A T 10: 106,835,725 E432D probably damaging Het
Prom1 T C 5: 44,037,509 D298G possibly damaging Het
Prr22 T A 17: 56,770,527 probably null Het
Sept2 T A 1: 93,497,466 probably null Het
Setdb1 C A 3: 95,340,307 V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 A405V probably damaging Het
Srrm1 G A 4: 135,340,926 R279* probably null Het
Ssh2 C G 11: 77,450,150 D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 D373G probably damaging Het
Trpm3 T C 19: 22,926,113 L921S probably benign Het
Ubqln3 T C 7: 104,141,617 N422S probably benign Het
Vmn2r105 C T 17: 20,228,541 V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 F353L probably damaging Het
Zfp462 G A 4: 55,023,433 C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 S320G probably damaging Het
Other mutations in Katnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Katnal1 APN 5 148893797 splice site probably benign
IGL02369:Katnal1 APN 5 148878927 missense probably benign 0.04
R0001:Katnal1 UTSW 5 148921275 missense probably damaging 0.98
R0230:Katnal1 UTSW 5 148918650 missense possibly damaging 0.60
R0308:Katnal1 UTSW 5 148878924 missense possibly damaging 0.95
R0591:Katnal1 UTSW 5 148892516 missense probably damaging 1.00
R1220:Katnal1 UTSW 5 148894251 missense probably benign 0.00
R1448:Katnal1 UTSW 5 148904676 missense probably benign 0.37
R2163:Katnal1 UTSW 5 148888936 missense probably damaging 1.00
R4791:Katnal1 UTSW 5 148904650 missense probably damaging 1.00
R5168:Katnal1 UTSW 5 148921322 missense possibly damaging 0.91
R6182:Katnal1 UTSW 5 148904597 missense possibly damaging 0.83
R6836:Katnal1 UTSW 5 148894164 missense probably damaging 1.00
R7077:Katnal1 UTSW 5 148891737 missense probably benign 0.00
R7490:Katnal1 UTSW 5 148891682 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- TGGAGCCAGCAGACTGTATG -3'
(R):5'- CTGTAGTAATGGAAGTGCTGAGAAC -3'

Sequencing Primer
(F):5'- CCAGCAGACTGTATGATCATACCTTG -3'
(R):5'- CAGGTGCAGGGATGGCTG -3'
Posted On2018-06-06