Incidental Mutation 'R6542:Isoc2b'
ID520835
Institutional Source Beutler Lab
Gene Symbol Isoc2b
Ensembl Gene ENSMUSG00000052605
Gene Nameisochorismatase domain containing 2b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R6542 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4844959-4870258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4851455 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 26 (K26E)
Ref Sequence ENSEMBL: ENSMUSP00000147085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064547] [ENSMUST00000208816]
Predicted Effect probably damaging
Transcript: ENSMUST00000064547
AA Change: K26E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066859
Gene: ENSMUSG00000052605
AA Change: K26E

DomainStartEndE-ValueType
Pfam:Isochorismatase 16 163 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208173
Predicted Effect probably damaging
Transcript: ENSMUST00000208816
AA Change: K26E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,883,055 L566Q probably damaging Het
Apbb1ip C T 2: 22,874,960 T551I probably benign Het
Aqp5 A G 15: 99,594,262 E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 F306S probably damaging Het
Ccdc114 G T 7: 45,948,390 A575S probably benign Het
Clca3a1 C T 3: 144,759,260 V71I probably benign Het
Cog4 A G 8: 110,851,362 D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 probably benign Het
Dync1li2 C T 8: 104,442,764 G13D probably benign Het
F5 T C 1: 164,194,468 V1504A probably benign Het
Fancm T C 12: 65,097,429 L555P probably damaging Het
Fgfr2 A T 7: 130,201,123 S152T probably benign Het
Fign A T 2: 63,980,295 H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 M20K probably benign Het
Katnal1 C T 5: 148,876,206 A467T probably benign Het
Loxl3 A G 6: 83,048,166 T292A probably benign Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 V174D probably damaging Het
Metrnl A C 11: 121,702,878 probably null Het
Midn A G 10: 80,156,584 D490G probably damaging Het
Mmp10 G A 9: 7,506,512 A330T probably benign Het
Mto1 T A 9: 78,457,228 C281S possibly damaging Het
Nek10 A G 14: 14,999,108 I1036V probably benign Het
Olfr1535 T C 13: 21,555,507 T172A probably damaging Het
Olfr157 A C 4: 43,835,686 L268R probably benign Het
Olfr374 T C 8: 72,109,871 F102L probably damaging Het
Olfr912 C A 9: 38,539,437 L181I probably benign Het
Parp4 A C 14: 56,647,882 I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 Y212C probably damaging Het
Pilra G T 5: 137,821,975 probably null Het
Pkhd1 A G 1: 20,585,703 I202T probably benign Het
Ppfia2 A T 10: 106,835,725 E432D probably damaging Het
Prom1 T C 5: 44,037,509 D298G possibly damaging Het
Prr22 T A 17: 56,770,527 probably null Het
Sept2 T A 1: 93,497,466 probably null Het
Setdb1 C A 3: 95,340,307 V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 A405V probably damaging Het
Srrm1 G A 4: 135,340,926 R279* probably null Het
Ssh2 C G 11: 77,450,150 D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 D373G probably damaging Het
Trpm3 T C 19: 22,926,113 L921S probably benign Het
Ubqln3 T C 7: 104,141,617 N422S probably benign Het
Vmn2r105 C T 17: 20,228,541 V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 F353L probably damaging Het
Zfp462 G A 4: 55,023,433 C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 S320G probably damaging Het
Other mutations in Isoc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Isoc2b APN 7 4850764 missense probably damaging 1.00
R2112:Isoc2b UTSW 7 4849475 missense probably damaging 1.00
R2130:Isoc2b UTSW 7 4851439 missense probably damaging 0.96
R2193:Isoc2b UTSW 7 4850824 missense probably benign 0.00
R4411:Isoc2b UTSW 7 4849434 intron probably benign
R5355:Isoc2b UTSW 7 4849358 intron probably benign
R5497:Isoc2b UTSW 7 4850783 missense probably benign 0.02
R5831:Isoc2b UTSW 7 4851024 missense probably null 0.38
R5907:Isoc2b UTSW 7 4849578 splice site probably null
R6766:Isoc2b UTSW 7 4851062 missense probably damaging 1.00
R6891:Isoc2b UTSW 7 4851488 missense probably damaging 0.99
R7475:Isoc2b UTSW 7 4851085 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAAGACATTGTGCTAGAACCC -3'
(R):5'- TGCAGGAAGACAAGGCTCAC -3'

Sequencing Primer
(F):5'- CATTGTGCTAGAACCCAAGGATGC -3'
(R):5'- CAGGCCACAGAGCCAAGTG -3'
Posted On2018-06-06