Incidental Mutation 'R6542:Ubqln3'
ID 520840
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R6542 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 104140623-104143279 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104141617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 422 (N422S)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: N422S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: N422S

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,883,055 L566Q probably damaging Het
Apbb1ip C T 2: 22,874,960 T551I probably benign Het
Aqp5 A G 15: 99,594,262 E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 F306S probably damaging Het
Ccdc114 G T 7: 45,948,390 A575S probably benign Het
Clca3a1 C T 3: 144,759,260 V71I probably benign Het
Cog4 A G 8: 110,851,362 D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 probably benign Het
Dync1li2 C T 8: 104,442,764 G13D probably benign Het
F5 T C 1: 164,194,468 V1504A probably benign Het
Fancm T C 12: 65,097,429 L555P probably damaging Het
Fgfr2 A T 7: 130,201,123 S152T probably benign Het
Fign A T 2: 63,980,295 H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 M20K probably benign Het
Isoc2b T C 7: 4,851,455 K26E probably damaging Het
Katnal1 C T 5: 148,876,206 A467T probably benign Het
Loxl3 A G 6: 83,048,166 T292A probably benign Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 V174D probably damaging Het
Metrnl A C 11: 121,702,878 probably null Het
Midn A G 10: 80,156,584 D490G probably damaging Het
Mmp10 G A 9: 7,506,512 A330T probably benign Het
Mto1 T A 9: 78,457,228 C281S possibly damaging Het
Nek10 A G 14: 14,999,108 I1036V probably benign Het
Olfr1535 T C 13: 21,555,507 T172A probably damaging Het
Olfr157 A C 4: 43,835,686 L268R probably benign Het
Olfr374 T C 8: 72,109,871 F102L probably damaging Het
Olfr912 C A 9: 38,539,437 L181I probably benign Het
Parp4 A C 14: 56,647,882 I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 Y212C probably damaging Het
Pilra G T 5: 137,821,975 probably null Het
Pkhd1 A G 1: 20,585,703 I202T probably benign Het
Ppfia2 A T 10: 106,835,725 E432D probably damaging Het
Prom1 T C 5: 44,037,509 D298G possibly damaging Het
Prr22 T A 17: 56,770,527 probably null Het
Sept2 T A 1: 93,497,466 probably null Het
Setdb1 C A 3: 95,340,307 V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 A405V probably damaging Het
Srrm1 G A 4: 135,340,926 R279* probably null Het
Ssh2 C G 11: 77,450,150 D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 D373G probably damaging Het
Trpm3 T C 19: 22,926,113 L921S probably benign Het
Vmn2r105 C T 17: 20,228,541 V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 F353L probably damaging Het
Zfp462 G A 4: 55,023,433 C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 S320G probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 104141192 missense probably benign 0.03
R7961:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R9619:Ubqln3 UTSW 7 104141846 missense probably benign 0.05
R9652:Ubqln3 UTSW 7 104142755 missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTTGATTTGTGCCCGCTG -3'
(R):5'- CAGGGTACTGTGCCAACTTC -3'

Sequencing Primer
(F):5'- CTCAGAGATCTTGAGTAACCTGTTG -3'
(R):5'- GGGTACTGTGCCAACTTCAAATC -3'
Posted On 2018-06-06