Incidental Mutation 'R6542:Olfr912'
ID520852
Institutional Source Beutler Lab
Gene Symbol Olfr912
Ensembl Gene ENSMUSG00000111448
Gene Nameolfactory receptor 912
SynonymsMOR165-4, GA_x6K02T2PVTD-32283590-32284522
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R6542 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38580178-38586876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 38539437 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 181 (L181I)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000215122
AA Change: L181I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,883,055 L566Q probably damaging Het
Apbb1ip C T 2: 22,874,960 T551I probably benign Het
Aqp5 A G 15: 99,594,262 E247G probably damaging Het
Bdkrb1 T C 12: 105,605,093 F306S probably damaging Het
Ccdc114 G T 7: 45,948,390 A575S probably benign Het
Clca3a1 C T 3: 144,759,260 V71I probably benign Het
Cog4 A G 8: 110,851,362 D36G probably damaging Het
Ctbp1 A G 5: 33,269,571 probably benign Het
Dync1li2 C T 8: 104,442,764 G13D probably benign Het
F5 T C 1: 164,194,468 V1504A probably benign Het
Fancm T C 12: 65,097,429 L555P probably damaging Het
Fgfr2 A T 7: 130,201,123 S152T probably benign Het
Fign A T 2: 63,980,295 H210Q possibly damaging Het
Hbs1l A G 10: 21,304,617 N66S probably benign Het
Ighv12-3 A T 12: 114,366,815 M20K probably benign Het
Isoc2b T C 7: 4,851,455 K26E probably damaging Het
Katnal1 C T 5: 148,876,206 A467T probably benign Het
Loxl3 A G 6: 83,048,166 T292A probably benign Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mcur1 A T 13: 43,551,658 V174D probably damaging Het
Metrnl A C 11: 121,702,878 probably null Het
Midn A G 10: 80,156,584 D490G probably damaging Het
Mmp10 G A 9: 7,506,512 A330T probably benign Het
Mto1 T A 9: 78,457,228 C281S possibly damaging Het
Nek10 A G 14: 14,999,108 I1036V probably benign Het
Olfr1535 T C 13: 21,555,507 T172A probably damaging Het
Olfr157 A C 4: 43,835,686 L268R probably benign Het
Olfr374 T C 8: 72,109,871 F102L probably damaging Het
Parp4 A C 14: 56,647,882 I1473L unknown Het
Pcdhb9 A G 18: 37,401,589 Y212C probably damaging Het
Pilra G T 5: 137,821,975 probably null Het
Pkhd1 A G 1: 20,585,703 I202T probably benign Het
Ppfia2 A T 10: 106,835,725 E432D probably damaging Het
Prom1 T C 5: 44,037,509 D298G possibly damaging Het
Prr22 T A 17: 56,770,527 probably null Het
Sept2 T A 1: 93,497,466 probably null Het
Setdb1 C A 3: 95,340,307 V426L probably damaging Het
Slc8b1 C T 5: 120,529,517 A405V probably damaging Het
Srrm1 G A 4: 135,340,926 R279* probably null Het
Ssh2 C G 11: 77,450,150 D709E possibly damaging Het
Tmprss9 A G 10: 80,888,555 D373G probably damaging Het
Trpm3 T C 19: 22,926,113 L921S probably benign Het
Ubqln3 T C 7: 104,141,617 N422S probably benign Het
Vmn2r105 C T 17: 20,228,541 V125I probably benign Het
Vmn2r69 A T 7: 85,411,205 Y390* probably null Het
Zcwpw1 T C 5: 137,812,020 F353L probably damaging Het
Zfp462 G A 4: 55,023,433 C987Y probably damaging Het
Zkscan4 A G 13: 21,484,338 S320G probably damaging Het
Other mutations in Olfr912
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr912 APN 9 38581376 missense probably damaging 0.97
IGL01099:Olfr912 APN 9 38582077 missense probably benign 0.00
IGL01749:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01750:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01751:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01752:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01753:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02262:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02264:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02298:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02305:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581433 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02317:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02401:Olfr912 APN 9 38581355 missense probably damaging 1.00
R0311:Olfr912 UTSW 9 38539297 missense probably benign 0.42
R0973:Olfr912 UTSW 9 38581283 missense possibly damaging 0.74
R1552:Olfr912 UTSW 9 38581379 missense probably benign 0.00
R1720:Olfr912 UTSW 9 38581289 missense probably benign
R2149:Olfr912 UTSW 9 38581508 missense probably benign 0.02
R2241:Olfr912 UTSW 9 38581805 missense probably damaging 1.00
R3622:Olfr912 UTSW 9 38581496 missense probably damaging 1.00
R4384:Olfr912 UTSW 9 38582053 missense probably damaging 1.00
R4686:Olfr912 UTSW 9 38582031 missense probably damaging 1.00
R4780:Olfr912 UTSW 9 38581969 missense possibly damaging 0.84
R5221:Olfr912 UTSW 9 38581852 missense probably damaging 1.00
R5503:Olfr912 UTSW 9 38582072 missense probably benign
R5887:Olfr912 UTSW 9 38581784 missense probably damaging 1.00
R6062:Olfr912 UTSW 9 38539144 missense probably damaging 0.97
R6516:Olfr912 UTSW 9 38581472 missense probably damaging 1.00
R6766:Olfr912 UTSW 9 38581773 missense probably damaging 1.00
R7057:Olfr912 UTSW 9 38581754 missense probably damaging 1.00
R7112:Olfr912 UTSW 9 38582034 nonsense probably null
R7414:Olfr912 UTSW 9 38581468 missense probably benign 0.00
R7514:Olfr912 UTSW 9 38582051 missense probably damaging 0.96
Z1176:Olfr912 UTSW 9 38581885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGACAGCAATGGCCTATG -3'
(R):5'- CAGCAATTATATGAGAACTGCAGG -3'

Sequencing Primer
(F):5'- CAGCAATGGCCTATGATCGCTATG -3'
(R):5'- ACTGCAGGTGTTGAAGGC -3'
Posted On2018-06-06