Incidental Mutation 'R6518:4921539E11Rik'
ID 520857
Institutional Source Beutler Lab
Gene Symbol 4921539E11Rik
Ensembl Gene ENSMUSG00000028520
Gene Name RIKEN cDNA 4921539E11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R6518 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 103230445-103290863 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103266411 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 88 (D88G)
Ref Sequence ENSEMBL: ENSMUSP00000095557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030245] [ENSMUST00000097944] [ENSMUST00000168664]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030245
AA Change: D88G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030245
Gene: ENSMUSG00000028520
AA Change: D88G

DomainStartEndE-ValueType
Pfam:DUF4545 1 443 6.1e-206 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097944
AA Change: D88G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095557
Gene: ENSMUSG00000028520
AA Change: D88G

DomainStartEndE-ValueType
Pfam:DUF4545 1 270 7.3e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168664
SMART Domains Protein: ENSMUSP00000131846
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 342 4.4e-183 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,509,089 Het
Angptl6 T C 9: 20,875,360 H330R probably damaging Het
Asxl3 T A 18: 22,516,340 V462E probably damaging Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
C1ra T A 6: 124,521,575 probably null Het
C2 T A 17: 34,864,118 I426F probably damaging Het
C4b A T 17: 34,734,205 Y1049N probably damaging Het
Cdkn1b T A 6: 134,921,320 M134K probably benign Het
Cenpn A G 8: 116,937,165 D145G possibly damaging Het
Ckap2 A T 8: 22,173,303 I492K probably benign Het
Cog2 G A 8: 124,527,103 W67* probably null Het
Col7a1 T C 9: 108,955,527 F172L unknown Het
Dcaf1 T C 9: 106,835,589 I112T probably damaging Het
Ddx4 T C 13: 112,604,547 I518V probably benign Het
Dnah10 T C 5: 124,758,355 L908P probably damaging Het
Dsg3 T C 18: 20,533,422 Y563H probably benign Het
Gm12394 A G 4: 42,791,750 I794T probably benign Het
Gm16686 A C 4: 88,755,488 probably benign Het
Gpr139 A T 7: 119,144,511 F284I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ice1 A T 13: 70,606,309 F553I possibly damaging Het
Igkv6-29 T A 6: 70,138,513 Q99L probably damaging Het
Lipt1 A G 1: 37,875,775 N304S probably benign Het
Lmo1 A C 7: 109,143,576 L39R probably damaging Het
Mcc T A 18: 44,661,811 probably benign Het
Mindy3 T C 2: 12,382,129 T74A probably damaging Het
Olfr1507 T C 14: 52,490,620 I115V probably damaging Het
Olfr71 A G 4: 43,706,334 V78A probably benign Het
Olfr96 G T 17: 37,225,268 A48S probably benign Het
Ormdl1 T C 1: 53,308,957 Y153H probably benign Het
Pdzrn3 A T 6: 101,150,514 *1064K probably null Het
Pias1 A G 9: 62,951,860 L113P probably damaging Het
Piezo2 A T 18: 63,106,271 I514N probably damaging Het
Prkd1 T C 12: 50,425,495 T212A probably benign Het
Rnf219 A T 14: 104,479,065 L624H probably damaging Het
Rsph10b A G 5: 143,963,873 Y151C probably damaging Het
Samhd1 G A 2: 157,114,297 T325M possibly damaging Het
Seh1l A G 18: 67,789,449 T291A probably damaging Het
Smim24 A G 10: 81,393,861 M1V probably null Het
Sp140 TTTTTTTTTTTT TTTTTTTTTTTTTTTTT 1: 85,644,570 probably benign Het
Speer3 T G 5: 13,795,448 I165S possibly damaging Het
Timm23 A G 14: 32,201,637 probably null Het
Tmem17 A T 11: 22,517,427 Y75F possibly damaging Het
Tmem86b A T 7: 4,629,609 C85* probably null Het
Try5 A G 6: 41,314,679 F6S probably benign Het
Vmn2r71 G T 7: 85,621,228 C534F probably damaging Het
Vmn2r85 A T 10: 130,429,412 D67E probably benign Het
Wars2 A T 3: 99,216,800 M326L probably benign Het
Wdr70 A T 15: 8,079,337 S108R unknown Het
Zfp677 A G 17: 21,398,130 H483R probably damaging Het
Other mutations in 4921539E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:4921539E11Rik APN 4 103235786 missense possibly damaging 0.95
IGL00864:4921539E11Rik APN 4 103235698 missense probably damaging 1.00
IGL01951:4921539E11Rik APN 4 103235668 missense probably damaging 1.00
IGL02477:4921539E11Rik APN 4 103270746 missense probably benign 0.04
IGL02606:4921539E11Rik APN 4 103242781 missense probably benign 0.01
IGL03210:4921539E11Rik APN 4 103284438 missense probably benign 0.01
BB004:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
BB014:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
R0441:4921539E11Rik UTSW 4 103235492 intron probably benign
R0455:4921539E11Rik UTSW 4 103230983 missense possibly damaging 0.69
R0504:4921539E11Rik UTSW 4 103270860 splice site probably benign
R0636:4921539E11Rik UTSW 4 103231217 missense probably damaging 1.00
R0766:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R0799:4921539E11Rik UTSW 4 103242904 missense possibly damaging 0.83
R1312:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R1713:4921539E11Rik UTSW 4 103270767 missense possibly damaging 0.92
R1783:4921539E11Rik UTSW 4 103231089 missense probably damaging 0.99
R1978:4921539E11Rik UTSW 4 103270764 missense possibly damaging 0.49
R3735:4921539E11Rik UTSW 4 103266406 missense probably damaging 1.00
R4821:4921539E11Rik UTSW 4 103235674 missense probably damaging 1.00
R5274:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5275:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5431:4921539E11Rik UTSW 4 103270848 missense probably benign 0.00
R5449:4921539E11Rik UTSW 4 103266382 missense probably benign
R6049:4921539E11Rik UTSW 4 103231323 missense probably benign 0.05
R6277:4921539E11Rik UTSW 4 103231471 nonsense probably null
R6602:4921539E11Rik UTSW 4 103255572 missense probably benign 0.36
R6634:4921539E11Rik UTSW 4 103236930 critical splice donor site probably null
R6992:4921539E11Rik UTSW 4 103242793 missense possibly damaging 0.57
R7575:4921539E11Rik UTSW 4 103230995 missense probably damaging 1.00
R7927:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
R8130:4921539E11Rik UTSW 4 103235698 missense probably damaging 1.00
R8461:4921539E11Rik UTSW 4 103255515 missense probably benign 0.01
R8714:4921539E11Rik UTSW 4 103242896 missense probably benign 0.10
R8798:4921539E11Rik UTSW 4 103266377 start gained probably benign
R9458:4921539E11Rik UTSW 4 103284411 missense possibly damaging 0.81
R9462:4921539E11Rik UTSW 4 103235767 missense probably benign 0.08
R9598:4921539E11Rik UTSW 4 103231407 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGTTAAGATACCAGAAGGAGGG -3'
(R):5'- TTCCTACCCTGGCAGTACTACC -3'

Sequencing Primer
(F):5'- CACAGAGCATTACCCATTA -3'
(R):5'- AGCAACACTTCAGGCTTCTTCTCTAG -3'
Posted On 2018-06-06