Incidental Mutation 'R6518:4921539E11Rik'
ID520857
Institutional Source Beutler Lab
Gene Symbol 4921539E11Rik
Ensembl Gene ENSMUSG00000028520
Gene NameRIKEN cDNA 4921539E11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6518 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location103230445-103290863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103266411 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 88 (D88G)
Ref Sequence ENSEMBL: ENSMUSP00000095557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030245] [ENSMUST00000097944] [ENSMUST00000168664]
Predicted Effect probably damaging
Transcript: ENSMUST00000030245
AA Change: D88G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030245
Gene: ENSMUSG00000028520
AA Change: D88G

DomainStartEndE-ValueType
Pfam:DUF4545 1 443 6.1e-206 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097944
AA Change: D88G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095557
Gene: ENSMUSG00000028520
AA Change: D88G

DomainStartEndE-ValueType
Pfam:DUF4545 1 270 7.3e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168664
SMART Domains Protein: ENSMUSP00000131846
Gene: ENSMUSG00000028520

DomainStartEndE-ValueType
Pfam:DUF4545 1 342 4.4e-183 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,509,089 Het
Angptl6 T C 9: 20,875,360 H330R probably damaging Het
Asxl3 T A 18: 22,516,340 V462E probably damaging Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
C1ra T A 6: 124,521,575 probably null Het
C2 T A 17: 34,864,118 I426F probably damaging Het
C4b A T 17: 34,734,205 Y1049N probably damaging Het
Cdkn1b T A 6: 134,921,320 M134K probably benign Het
Cenpn A G 8: 116,937,165 D145G possibly damaging Het
Ckap2 A T 8: 22,173,303 I492K probably benign Het
Cog2 G A 8: 124,527,103 W67* probably null Het
Col7a1 T C 9: 108,955,527 F172L unknown Het
Dcaf1 T C 9: 106,835,589 I112T probably damaging Het
Ddx4 T C 13: 112,604,547 I518V probably benign Het
Dnah10 T C 5: 124,758,355 L908P probably damaging Het
Dsg3 T C 18: 20,533,422 Y563H probably benign Het
Gm12394 A G 4: 42,791,750 I794T probably benign Het
Gm16686 A C 4: 88,755,488 probably benign Het
Gpr139 A T 7: 119,144,511 F284I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ice1 A T 13: 70,606,309 F553I possibly damaging Het
Igkv6-29 T A 6: 70,138,513 Q99L probably damaging Het
Lipt1 A G 1: 37,875,775 N304S probably benign Het
Lmo1 A C 7: 109,143,576 L39R probably damaging Het
Mcc T A 18: 44,661,811 probably benign Het
Mindy3 T C 2: 12,382,129 T74A probably damaging Het
Olfr1507 T C 14: 52,490,620 I115V probably damaging Het
Olfr71 A G 4: 43,706,334 V78A probably benign Het
Olfr96 G T 17: 37,225,268 A48S probably benign Het
Ormdl1 T C 1: 53,308,957 Y153H probably benign Het
Pdzrn3 A T 6: 101,150,514 *1064K probably null Het
Pias1 A G 9: 62,951,860 L113P probably damaging Het
Piezo2 A T 18: 63,106,271 I514N probably damaging Het
Prkd1 T C 12: 50,425,495 T212A probably benign Het
Rnf219 A T 14: 104,479,065 L624H probably damaging Het
Rsph10b A G 5: 143,963,873 Y151C probably damaging Het
Samhd1 G A 2: 157,114,297 T325M possibly damaging Het
Seh1l A G 18: 67,789,449 T291A probably damaging Het
Smim24 A G 10: 81,393,861 M1V probably null Het
Sp140 TTTTTTTTTTTT TTTTTTTTTTTTTTTTT 1: 85,644,570 probably benign Het
Speer3 T G 5: 13,795,448 I165S possibly damaging Het
Timm23 A G 14: 32,201,637 probably null Het
Tmem17 A T 11: 22,517,427 Y75F possibly damaging Het
Tmem86b A T 7: 4,629,609 C85* probably null Het
Try5 A G 6: 41,314,679 F6S probably benign Het
Vmn2r71 G T 7: 85,621,228 C534F probably damaging Het
Vmn2r85 A T 10: 130,429,412 D67E probably benign Het
Wars2 A T 3: 99,216,800 M326L probably benign Het
Wdr70 A T 15: 8,079,337 S108R unknown Het
Zfp677 A G 17: 21,398,130 H483R probably damaging Het
Other mutations in 4921539E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:4921539E11Rik APN 4 103235786 missense possibly damaging 0.95
IGL00864:4921539E11Rik APN 4 103235698 missense probably damaging 1.00
IGL01951:4921539E11Rik APN 4 103235668 missense probably damaging 1.00
IGL02477:4921539E11Rik APN 4 103270746 missense probably benign 0.04
IGL02606:4921539E11Rik APN 4 103242781 missense probably benign 0.01
IGL03210:4921539E11Rik APN 4 103284438 missense probably benign 0.01
BB004:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
BB014:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
R0441:4921539E11Rik UTSW 4 103235492 intron probably benign
R0455:4921539E11Rik UTSW 4 103230983 missense possibly damaging 0.69
R0504:4921539E11Rik UTSW 4 103270860 splice site probably benign
R0636:4921539E11Rik UTSW 4 103231217 missense probably damaging 1.00
R0766:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R0799:4921539E11Rik UTSW 4 103242904 missense possibly damaging 0.83
R1312:4921539E11Rik UTSW 4 103270797 missense probably damaging 0.99
R1713:4921539E11Rik UTSW 4 103270767 missense possibly damaging 0.92
R1783:4921539E11Rik UTSW 4 103231089 missense probably damaging 0.99
R1978:4921539E11Rik UTSW 4 103270764 missense possibly damaging 0.49
R3735:4921539E11Rik UTSW 4 103266406 missense probably damaging 1.00
R4821:4921539E11Rik UTSW 4 103235674 missense probably damaging 1.00
R5274:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5275:4921539E11Rik UTSW 4 103235659 missense probably benign 0.22
R5431:4921539E11Rik UTSW 4 103270848 missense probably benign 0.00
R5449:4921539E11Rik UTSW 4 103266382 missense probably benign
R6049:4921539E11Rik UTSW 4 103231323 missense probably benign 0.05
R6277:4921539E11Rik UTSW 4 103231471 nonsense probably null
R6602:4921539E11Rik UTSW 4 103255572 missense probably benign 0.36
R6634:4921539E11Rik UTSW 4 103236930 critical splice donor site probably null
R6992:4921539E11Rik UTSW 4 103242793 missense possibly damaging 0.57
R7575:4921539E11Rik UTSW 4 103230995 missense probably damaging 1.00
R7927:4921539E11Rik UTSW 4 103266342 missense probably benign 0.02
R8130:4921539E11Rik UTSW 4 103235698 missense probably damaging 1.00
R8461:4921539E11Rik UTSW 4 103255515 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTTAAGATACCAGAAGGAGGG -3'
(R):5'- TTCCTACCCTGGCAGTACTACC -3'

Sequencing Primer
(F):5'- CACAGAGCATTACCCATTA -3'
(R):5'- AGCAACACTTCAGGCTTCTTCTCTAG -3'
Posted On2018-06-06