Incidental Mutation 'R6518:Rsph10b'
ID520867
Institutional Source Beutler Lab
Gene Symbol Rsph10b
Ensembl Gene ENSMUSG00000075569
Gene Nameradial spoke head 10 homolog B (Chlamydomonas)
SynonymsRsph10b2, 4930526H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6518 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location143933035-143985719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143963873 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 151 (Y151C)
Ref Sequence ENSEMBL: ENSMUSP00000148444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166847] [ENSMUST00000212711]
Predicted Effect probably damaging
Transcript: ENSMUST00000166847
AA Change: Y573C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569
AA Change: Y573C

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167009
Predicted Effect probably damaging
Transcript: ENSMUST00000212711
AA Change: Y151C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,266,411 D88G probably damaging Het
Abcc12 A G 8: 86,509,089 Het
Angptl6 T C 9: 20,875,360 H330R probably damaging Het
Asxl3 T A 18: 22,516,340 V462E probably damaging Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
C1ra T A 6: 124,521,575 probably null Het
C2 T A 17: 34,864,118 I426F probably damaging Het
C4b A T 17: 34,734,205 Y1049N probably damaging Het
Cdkn1b T A 6: 134,921,320 M134K probably benign Het
Cenpn A G 8: 116,937,165 D145G possibly damaging Het
Ckap2 A T 8: 22,173,303 I492K probably benign Het
Cog2 G A 8: 124,527,103 W67* probably null Het
Col7a1 T C 9: 108,955,527 F172L unknown Het
Dcaf1 T C 9: 106,835,589 I112T probably damaging Het
Ddx4 T C 13: 112,604,547 I518V probably benign Het
Dnah10 T C 5: 124,758,355 L908P probably damaging Het
Dsg3 T C 18: 20,533,422 Y563H probably benign Het
Gm12394 A G 4: 42,791,750 I794T probably benign Het
Gm16686 A C 4: 88,755,488 probably benign Het
Gpr139 A T 7: 119,144,511 F284I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ice1 A T 13: 70,606,309 F553I possibly damaging Het
Igkv6-29 T A 6: 70,138,513 Q99L probably damaging Het
Lipt1 A G 1: 37,875,775 N304S probably benign Het
Lmo1 A C 7: 109,143,576 L39R probably damaging Het
Mcc T A 18: 44,661,811 probably benign Het
Mindy3 T C 2: 12,382,129 T74A probably damaging Het
Olfr1507 T C 14: 52,490,620 I115V probably damaging Het
Olfr71 A G 4: 43,706,334 V78A probably benign Het
Olfr96 G T 17: 37,225,268 A48S probably benign Het
Ormdl1 T C 1: 53,308,957 Y153H probably benign Het
Pdzrn3 A T 6: 101,150,514 *1064K probably null Het
Pias1 A G 9: 62,951,860 L113P probably damaging Het
Piezo2 A T 18: 63,106,271 I514N probably damaging Het
Prkd1 T C 12: 50,425,495 T212A probably benign Het
Rnf219 A T 14: 104,479,065 L624H probably damaging Het
Samhd1 G A 2: 157,114,297 T325M possibly damaging Het
Seh1l A G 18: 67,789,449 T291A probably damaging Het
Smim24 A G 10: 81,393,861 M1V probably null Het
Sp140 TTTTTTTTTTTT TTTTTTTTTTTTTTTTT 1: 85,644,570 probably benign Het
Speer3 T G 5: 13,795,448 I165S possibly damaging Het
Timm23 A G 14: 32,201,637 probably null Het
Tmem17 A T 11: 22,517,427 Y75F possibly damaging Het
Tmem86b A T 7: 4,629,609 C85* probably null Het
Try5 A G 6: 41,314,679 F6S probably benign Het
Vmn2r71 G T 7: 85,621,228 C534F probably damaging Het
Vmn2r85 A T 10: 130,429,412 D67E probably benign Het
Wars2 A T 3: 99,216,800 M326L probably benign Het
Wdr70 A T 15: 8,079,337 S108R unknown Het
Zfp677 A G 17: 21,398,130 H483R probably damaging Het
Other mutations in Rsph10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rsph10b APN 5 143937087 makesense probably null
K7894:Rsph10b UTSW 5 143944520 missense probably damaging 1.00
R0136:Rsph10b UTSW 5 143959821 missense probably benign 0.05
R0149:Rsph10b UTSW 5 143938909 unclassified probably benign
R0326:Rsph10b UTSW 5 143967128 missense probably damaging 1.00
R0558:Rsph10b UTSW 5 143949338 missense probably benign 0.02
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1185:Rsph10b UTSW 5 143966462 splice site probably benign
R1712:Rsph10b UTSW 5 143937149 missense probably damaging 0.96
R1832:Rsph10b UTSW 5 143967179 missense possibly damaging 0.79
R1909:Rsph10b UTSW 5 143985491 missense probably benign 0.09
R2044:Rsph10b UTSW 5 143967250 splice site probably null
R2155:Rsph10b UTSW 5 143961256 missense probably benign 0.05
R2842:Rsph10b UTSW 5 143979892 missense possibly damaging 0.81
R3805:Rsph10b UTSW 5 143958388 critical splice donor site probably null
R4031:Rsph10b UTSW 5 143985668 splice site probably null
R4792:Rsph10b UTSW 5 143937317 missense probably damaging 1.00
R4866:Rsph10b UTSW 5 143948529 missense probably benign 0.28
R6090:Rsph10b UTSW 5 143977128 missense probably benign 0.00
R6252:Rsph10b UTSW 5 143937121 missense possibly damaging 0.70
R6255:Rsph10b UTSW 5 143959746 missense probably damaging 1.00
R7085:Rsph10b UTSW 5 143949284 missense possibly damaging 0.82
R7206:Rsph10b UTSW 5 143961192 missense possibly damaging 0.86
R7337:Rsph10b UTSW 5 143961215 missense probably benign 0.11
R7353:Rsph10b UTSW 5 143967220 missense possibly damaging 0.73
R7567:Rsph10b UTSW 5 143949426 missense possibly damaging 0.78
R8022:Rsph10b UTSW 5 143967232 missense probably benign 0.00
R8109:Rsph10b UTSW 5 143985530 missense probably benign 0.00
R8275:Rsph10b UTSW 5 143966505 missense possibly damaging 0.50
Z1177:Rsph10b UTSW 5 143977134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATGCCTGTCAGGTAAAAGG -3'
(R):5'- TCCTGTGAAAGCATCTGGG -3'

Sequencing Primer
(F):5'- GCTCACATGTAAGCCAGAGGTTATC -3'
(R):5'- TGAAAGCATCTGGGGCCCAC -3'
Posted On2018-06-06