Incidental Mutation 'R6518:Col7a1'
ID 520903
Institutional Source Beutler Lab
Gene Symbol Col7a1
Ensembl Gene ENSMUSG00000025650
Gene Name collagen, type VII, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6518 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108953586-108984875 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108955527 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 172 (F172L)
Ref Sequence ENSEMBL: ENSMUSP00000107701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026740] [ENSMUST00000112070]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000026740
AA Change: F172L
SMART Domains Protein: ENSMUSP00000026740
Gene: ENSMUSG00000025650
AA Change: F172L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1227 2.3e-22 PFAM
Pfam:Collagen 1244 1311 2.4e-8 PFAM
Pfam:Collagen 1294 1355 4.1e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.8e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.4e-9 PFAM
Pfam:Collagen 2025 2092 9.1e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.5e-8 PFAM
Pfam:Collagen 2364 2423 7.3e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.4e-11 PFAM
Pfam:Collagen 2516 2572 1.9e-9 PFAM
Pfam:Collagen 2560 2630 7.2e-9 PFAM
Pfam:Collagen 2605 2682 6e-9 PFAM
Pfam:Collagen 2659 2722 2e-8 PFAM
low complexity region 2745 2775 N/A INTRINSIC
Pfam:Kunitz_BPTI 2878 2932 3.2e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112070
AA Change: F172L
SMART Domains Protein: ENSMUSP00000107701
Gene: ENSMUSG00000025650
AA Change: F172L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
VWA 37 217 1.56e-51 SMART
FN3 233 319 1.41e-10 SMART
FN3 325 405 6.54e-6 SMART
FN3 416 494 6.91e-5 SMART
FN3 509 585 1.24e-6 SMART
FN3 599 675 2.01e-6 SMART
FN3 687 763 7.45e-10 SMART
FN3 774 854 6.01e-5 SMART
FN3 865 944 7.23e-8 SMART
FN3 955 1038 2.16e-6 SMART
Pfam:VWA 1055 1230 2.2e-19 PFAM
Pfam:Collagen 1244 1311 2.5e-8 PFAM
Pfam:Collagen 1294 1355 4.2e-10 PFAM
low complexity region 1397 1414 N/A INTRINSIC
Pfam:Collagen 1447 1504 1.3e-9 PFAM
Pfam:Collagen 1487 1547 5.1e-8 PFAM
low complexity region 1572 1595 N/A INTRINSIC
low complexity region 1604 1632 N/A INTRINSIC
Pfam:Collagen 1646 1714 2.9e-10 PFAM
Pfam:Collagen 1713 1775 1.9e-10 PFAM
low complexity region 1776 1794 N/A INTRINSIC
low complexity region 1803 1833 N/A INTRINSIC
Pfam:Collagen 1875 1935 1.5e-8 PFAM
Pfam:Collagen 1969 2033 2.5e-9 PFAM
Pfam:Collagen 2025 2092 9.4e-10 PFAM
Pfam:Collagen 2089 2158 1.3e-10 PFAM
Pfam:Collagen 2147 2209 1.6e-9 PFAM
Pfam:Collagen 2195 2266 7.7e-7 PFAM
Pfam:Collagen 2245 2312 1.4e-8 PFAM
Pfam:Collagen 2313 2365 2.6e-8 PFAM
Pfam:Collagen 2364 2423 7.6e-10 PFAM
Pfam:Collagen 2398 2457 1.5e-9 PFAM
Pfam:Collagen 2456 2515 8.7e-11 PFAM
Pfam:Collagen 2516 2572 2e-9 PFAM
Pfam:Collagen 2560 2630 7.4e-9 PFAM
Pfam:Collagen 2605 2682 6.2e-9 PFAM
Pfam:Collagen 2659 2722 2.1e-8 PFAM
Pfam:Collagen 2719 2778 1.6e-7 PFAM
Pfam:Kunitz_BPTI 2878 2932 1.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193607
Meta Mutation Damage Score 0.1257 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type VII collagen. The type VII collagen fibril, composed of three identical alpha collagen chains, is restricted to the basement zone beneath stratified squamous epithelia. It functions as an anchoring fibril between the external epithelia and the underlying stroma. Mutations in this gene are associated with all forms of dystrophic epidermolysis bullosa. In the absence of mutations, however, an acquired form of this disease can result from an autoimmune response made to type VII collagen. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,266,411 D88G probably damaging Het
Abcc12 A G 8: 86,509,089 Het
Angptl6 T C 9: 20,875,360 H330R probably damaging Het
Asxl3 T A 18: 22,516,340 V462E probably damaging Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
C1ra T A 6: 124,521,575 probably null Het
C2 T A 17: 34,864,118 I426F probably damaging Het
C4b A T 17: 34,734,205 Y1049N probably damaging Het
Cdkn1b T A 6: 134,921,320 M134K probably benign Het
Cenpn A G 8: 116,937,165 D145G possibly damaging Het
Ckap2 A T 8: 22,173,303 I492K probably benign Het
Cog2 G A 8: 124,527,103 W67* probably null Het
Dcaf1 T C 9: 106,835,589 I112T probably damaging Het
Ddx4 T C 13: 112,604,547 I518V probably benign Het
Dnah10 T C 5: 124,758,355 L908P probably damaging Het
Dsg3 T C 18: 20,533,422 Y563H probably benign Het
Gm12394 A G 4: 42,791,750 I794T probably benign Het
Gm16686 A C 4: 88,755,488 probably benign Het
Gpr139 A T 7: 119,144,511 F284I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ice1 A T 13: 70,606,309 F553I possibly damaging Het
Igkv6-29 T A 6: 70,138,513 Q99L probably damaging Het
Lipt1 A G 1: 37,875,775 N304S probably benign Het
Lmo1 A C 7: 109,143,576 L39R probably damaging Het
Mcc T A 18: 44,661,811 probably benign Het
Mindy3 T C 2: 12,382,129 T74A probably damaging Het
Olfr1507 T C 14: 52,490,620 I115V probably damaging Het
Olfr71 A G 4: 43,706,334 V78A probably benign Het
Olfr96 G T 17: 37,225,268 A48S probably benign Het
Ormdl1 T C 1: 53,308,957 Y153H probably benign Het
Pdzrn3 A T 6: 101,150,514 *1064K probably null Het
Pias1 A G 9: 62,951,860 L113P probably damaging Het
Piezo2 A T 18: 63,106,271 I514N probably damaging Het
Prkd1 T C 12: 50,425,495 T212A probably benign Het
Rnf219 A T 14: 104,479,065 L624H probably damaging Het
Rsph10b A G 5: 143,963,873 Y151C probably damaging Het
Samhd1 G A 2: 157,114,297 T325M possibly damaging Het
Seh1l A G 18: 67,789,449 T291A probably damaging Het
Smim24 A G 10: 81,393,861 M1V probably null Het
Sp140 TTTTTTTTTTTT TTTTTTTTTTTTTTTTT 1: 85,644,570 probably benign Het
Speer3 T G 5: 13,795,448 I165S possibly damaging Het
Timm23 A G 14: 32,201,637 probably null Het
Tmem17 A T 11: 22,517,427 Y75F possibly damaging Het
Tmem86b A T 7: 4,629,609 C85* probably null Het
Try5 A G 6: 41,314,679 F6S probably benign Het
Vmn2r71 G T 7: 85,621,228 C534F probably damaging Het
Vmn2r85 A T 10: 130,429,412 D67E probably benign Het
Wars2 A T 3: 99,216,800 M326L probably benign Het
Wdr70 A T 15: 8,079,337 S108R unknown Het
Zfp677 A G 17: 21,398,130 H483R probably damaging Het
Other mutations in Col7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Col7a1 APN 9 108977697 nonsense probably null
IGL01366:Col7a1 APN 9 108977119 splice site probably benign
IGL01395:Col7a1 APN 9 108983912 unclassified probably benign
IGL01410:Col7a1 APN 9 108964618 missense unknown
IGL01902:Col7a1 APN 9 108977827 missense unknown
IGL01915:Col7a1 APN 9 108955745 missense unknown
IGL01936:Col7a1 APN 9 108967999 splice site probably benign
IGL01943:Col7a1 APN 9 108984016 critical splice acceptor site probably null
IGL02026:Col7a1 APN 9 108968029 missense probably damaging 1.00
IGL02168:Col7a1 APN 9 108984075 unclassified probably benign
IGL02504:Col7a1 APN 9 108980675 missense unknown
IGL02510:Col7a1 APN 9 108973231 splice site probably benign
IGL02559:Col7a1 APN 9 108973216 missense unknown
IGL02583:Col7a1 APN 9 108962229 missense unknown
IGL02728:Col7a1 APN 9 108984104 missense probably benign 0.39
IGL03003:Col7a1 APN 9 108974956 critical splice donor site probably null
IGL03096:Col7a1 APN 9 108955788 missense unknown
IGL03122:Col7a1 APN 9 108961683 missense unknown
IGL03212:Col7a1 APN 9 108974452 missense unknown
IGL03240:Col7a1 APN 9 108968373 missense probably null 1.00
IGL03355:Col7a1 APN 9 108978160 missense unknown
olivetti UTSW 9 108969961 missense probably damaging 1.00
smallified UTSW 9 108972813 critical splice donor site probably null
underwood UTSW 9 108968875 critical splice acceptor site probably null
PIT4131001:Col7a1 UTSW 9 108965921 splice site probably benign
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0007:Col7a1 UTSW 9 108961403 missense unknown
R0078:Col7a1 UTSW 9 108974913 splice site probably benign
R0091:Col7a1 UTSW 9 108967506 splice site probably benign
R0126:Col7a1 UTSW 9 108969583 splice site probably benign
R0244:Col7a1 UTSW 9 108972184 splice site probably null
R0331:Col7a1 UTSW 9 108967502 splice site probably benign
R0375:Col7a1 UTSW 9 108980237 missense unknown
R0601:Col7a1 UTSW 9 108980584 splice site probably benign
R0609:Col7a1 UTSW 9 108958147 missense unknown
R0709:Col7a1 UTSW 9 108961548 splice site probably benign
R0879:Col7a1 UTSW 9 108976091 splice site probably benign
R1175:Col7a1 UTSW 9 108955334 missense unknown
R1177:Col7a1 UTSW 9 108962441 missense unknown
R1435:Col7a1 UTSW 9 108963273 missense unknown
R1497:Col7a1 UTSW 9 108978825 missense unknown
R1549:Col7a1 UTSW 9 108955966 missense unknown
R1794:Col7a1 UTSW 9 108965928 missense unknown
R1801:Col7a1 UTSW 9 108960997 missense unknown
R1848:Col7a1 UTSW 9 108969565 missense possibly damaging 0.83
R1899:Col7a1 UTSW 9 108978888 missense unknown
R1944:Col7a1 UTSW 9 108960010 missense unknown
R1945:Col7a1 UTSW 9 108960010 missense unknown
R1955:Col7a1 UTSW 9 108955664 missense unknown
R2009:Col7a1 UTSW 9 108968875 critical splice acceptor site probably null
R2034:Col7a1 UTSW 9 108963007 missense unknown
R3148:Col7a1 UTSW 9 108961405 missense unknown
R3713:Col7a1 UTSW 9 108964440 nonsense probably null
R4078:Col7a1 UTSW 9 108960991 missense unknown
R4193:Col7a1 UTSW 9 108956672 missense unknown
R4232:Col7a1 UTSW 9 108972813 critical splice donor site probably null
R4528:Col7a1 UTSW 9 108959533 missense unknown
R4771:Col7a1 UTSW 9 108971925 missense probably damaging 0.99
R4820:Col7a1 UTSW 9 108968607 missense possibly damaging 0.72
R4896:Col7a1 UTSW 9 108957277 missense unknown
R4911:Col7a1 UTSW 9 108975219 missense unknown
R4915:Col7a1 UTSW 9 108966464 missense unknown
R4917:Col7a1 UTSW 9 108966464 missense unknown
R5001:Col7a1 UTSW 9 108965078 critical splice donor site probably null
R5352:Col7a1 UTSW 9 108961411 missense unknown
R5361:Col7a1 UTSW 9 108963224 missense unknown
R5730:Col7a1 UTSW 9 108972242 critical splice donor site probably null
R5838:Col7a1 UTSW 9 108978143 missense unknown
R5842:Col7a1 UTSW 9 108965815 missense unknown
R5932:Col7a1 UTSW 9 108980211 missense unknown
R6091:Col7a1 UTSW 9 108955334 missense unknown
R6144:Col7a1 UTSW 9 108974080 missense unknown
R6158:Col7a1 UTSW 9 108964603 missense unknown
R6170:Col7a1 UTSW 9 108966443 missense unknown
R6247:Col7a1 UTSW 9 108981062 unclassified probably benign
R6338:Col7a1 UTSW 9 108956633 missense unknown
R6339:Col7a1 UTSW 9 108956633 missense unknown
R6382:Col7a1 UTSW 9 108975393 missense unknown
R6533:Col7a1 UTSW 9 108961358 missense unknown
R6569:Col7a1 UTSW 9 108978110 splice site probably null
R6596:Col7a1 UTSW 9 108954341 unclassified probably benign
R6697:Col7a1 UTSW 9 108970533 missense probably damaging 1.00
R6753:Col7a1 UTSW 9 108958128 missense unknown
R6849:Col7a1 UTSW 9 108975053 missense unknown
R6915:Col7a1 UTSW 9 108967618 missense probably benign 0.02
R6974:Col7a1 UTSW 9 108969426 missense possibly damaging 0.82
R6991:Col7a1 UTSW 9 108983919 critical splice donor site probably null
R7028:Col7a1 UTSW 9 108963263 nonsense probably null
R7556:Col7a1 UTSW 9 108982465 splice site probably null
R7571:Col7a1 UTSW 9 108982707 missense probably null
R7815:Col7a1 UTSW 9 108969565 missense probably damaging 0.96
R7875:Col7a1 UTSW 9 108958695 missense unknown
R7931:Col7a1 UTSW 9 108980522 splice site probably benign
R8016:Col7a1 UTSW 9 108958644 missense unknown
R8038:Col7a1 UTSW 9 108957292 missense unknown
R8049:Col7a1 UTSW 9 108975563 missense unknown
R8098:Col7a1 UTSW 9 108956695 missense unknown
R8103:Col7a1 UTSW 9 108975384 missense unknown
R8128:Col7a1 UTSW 9 108955721 missense unknown
R8268:Col7a1 UTSW 9 108972989 missense unknown
R8274:Col7a1 UTSW 9 108969961 missense probably damaging 1.00
R8318:Col7a1 UTSW 9 108958374 missense unknown
R8751:Col7a1 UTSW 9 108967662 missense possibly damaging 0.92
R8824:Col7a1 UTSW 9 108967025 missense unknown
R9148:Col7a1 UTSW 9 108960206 missense unknown
R9170:Col7a1 UTSW 9 108956639 missense unknown
R9171:Col7a1 UTSW 9 108978885 missense unknown
R9236:Col7a1 UTSW 9 108960616 missense unknown
R9287:Col7a1 UTSW 9 108958389 missense unknown
R9378:Col7a1 UTSW 9 108958640 nonsense probably null
R9443:Col7a1 UTSW 9 108955991 missense unknown
R9486:Col7a1 UTSW 9 108982328 missense unknown
R9537:Col7a1 UTSW 9 108955352 nonsense probably null
R9559:Col7a1 UTSW 9 108957292 missense unknown
R9563:Col7a1 UTSW 9 108962741 missense unknown
R9565:Col7a1 UTSW 9 108962741 missense unknown
R9578:Col7a1 UTSW 9 108960282 missense unknown
R9664:Col7a1 UTSW 9 108983581 missense unknown
RF008:Col7a1 UTSW 9 108964479 missense unknown
X0023:Col7a1 UTSW 9 108984185 unclassified probably benign
Z1088:Col7a1 UTSW 9 108978500 splice site silent
Z1177:Col7a1 UTSW 9 108974923 missense unknown
Z1177:Col7a1 UTSW 9 108976051 missense unknown
Z1177:Col7a1 UTSW 9 108984077 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCAAGGTGTTCCCTATAAACC -3'
(R):5'- TGCACACCCTCCTGGAAATG -3'

Sequencing Primer
(F):5'- CTACCATGCCTGCAAATGTG -3'
(R):5'- CCTCAAGATGCTGAAGTCATTGACG -3'
Posted On 2018-06-06