Incidental Mutation 'R6543:Focad'
ID520916
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.556) question?
Stock #R6543 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88279256 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 629 (S629P)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: S715P
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: S715P

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: S629P
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: S629P

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il20ra G A 10: 19,749,323 A117T probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
Mtor T A 4: 148,545,596 I2250N probably damaging Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prokr2 T A 2: 132,373,899 Q53L probably benign Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Rsg1 T G 4: 141,217,288 V50G probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Slfn5 T A 11: 82,958,666 probably null Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trav6-3 T C 14: 53,428,762 M1T probably null Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R6928:Focad UTSW 4 88348875 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
R7789:Focad UTSW 4 88229406 missense unknown
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CTTGATGCTGATCAGTCACTCTTAC -3'
(R):5'- TGCATGGGAGCTACACCTAC -3'

Sequencing Primer
(F):5'- GAGAACCAGTTTCTTTTCTCAAGTG -3'
(R):5'- ACAGGTACATATATACACTCATCAGG -3'
Posted On2018-06-06