Mutagenetix > Incidental Mutations

Incidental Mutation 'R6543:Focad'

520916

Institutional Source

Beutler Lab

Gene Symbol

Focad

Ensembl Gene

ENSMUSG00000038368

Gene Name

focadhesin

Synonyms

BC057079

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.454) question?

Stock #

R6543 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88094629-88411011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88279256 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 629 (S629P)

Ref Sequence

ENSEMBL: ENSMUSP00000124298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]

Predicted Effect

unknown
Transcript: ENSMUST00000097992
AA Change: S715P

SMART Domains

Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: S715P

Domain	Start	End	E-Value	Type
low complexity region	150	161	N/A	INTRINSIC
low complexity region	194	203	N/A	INTRINSIC
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	490	714	1.5e-71	PFAM
low complexity region	957	969	N/A	INTRINSIC
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1200	1209	N/A	INTRINSIC
Pfam:DUF3028	1210	1798	1.5e-291	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000159342
AA Change: S629P

SMART Domains

Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: S629P

Domain	Start	End	E-Value	Type
Pfam:DUF3730	20	250	5.8e-27	PFAM
low complexity region	264	273	N/A	INTRINSIC
low complexity region	328	338	N/A	INTRINSIC
low complexity region	348	361	N/A	INTRINSIC
Pfam:DUF3730	403	633	2.8e-61	PFAM
low complexity region	871	883	N/A	INTRINSIC
low complexity region	946	961	N/A	INTRINSIC
low complexity region	1114	1123	N/A	INTRINSIC
Pfam:DUF3028	1124	1712	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap4e1	T	C	2: 127,066,605	V1091A	probably benign	Het
Arhgef11	A	G	3: 87,733,408	N1320D	probably benign	Het
Atl3	T	A	19: 7,510,098	F126Y	probably damaging	Het
Borcs5	C	T	6: 134,710,180	T167M	probably damaging	Het
Creld2	A	G	15: 88,825,278	T331A	probably benign	Het
Cuzd1	A	G	7: 131,309,768	V494A	probably damaging	Het
Dclk1	C	T	3: 55,500,131	P244S	probably damaging	Het
Esyt3	T	C	9: 99,338,772	N126S	possibly damaging	Het
Gm11236	A	G	4: 73,638,978	E16G	probably damaging	Het
Gm17660	T	C	5: 104,074,875		probably benign	Het
Grip1	T	C	10: 119,985,594	L389P	probably benign	Het
Igkv4-91	A	T	6: 68,768,598	D105E	probably damaging	Het
Il20ra	G	A	10: 19,749,323	A117T	probably damaging	Het
Il6ra	A	G	3: 89,876,863	V367A	probably damaging	Het
Itga8	C	T	2: 12,301,644	V47M	probably damaging	Het
Limk2	T	C	11: 3,350,682	Y220C	probably damaging	Het
Lims1	T	A	10: 58,412,451	C243*	probably null	Het
Man1a	C	A	10: 53,934,981	G435*	probably null	Het
Mtor	T	A	4: 148,545,596	I2250N	probably damaging	Het
N4bp1	G	A	8: 86,861,906	Q135*	probably null	Het
Nbeal2	A	T	9: 110,644,458	D76E	probably benign	Het
Nbn	T	C	4: 15,986,605	S669P	probably benign	Het
Nfrkb	C	T	9: 31,400,985	Q456*	probably null	Het
Olfr803	C	A	10: 129,691,990	G17V	probably benign	Het
Pcnx3	C	T	19: 5,665,247	A1557T	probably benign	Het
Pgd	C	T	4: 149,160,752		probably null	Het
Prokr2	T	A	2: 132,373,899	Q53L	probably benign	Het
Pxmp4	C	A	2: 154,588,059	A137S	possibly damaging	Het
Rasef	C	T	4: 73,780,519		probably benign	Het
Rsg1	T	G	4: 141,217,288	V50G	probably benign	Het
Scrt2	C	T	2: 152,093,143	A72V	probably benign	Het
Sipa1l2	T	C	8: 125,450,362	E1171G	possibly damaging	Het
Slc26a8	T	C	17: 28,638,401	T923A	possibly damaging	Het
Slco1a6	T	C	6: 142,133,146	K141R	probably benign	Het
Slfn5	T	A	11: 82,958,666		probably null	Het
Sympk	A	T	7: 19,036,830	H282L	probably damaging	Het
Tnr	A	G	1: 159,924,107	Y1324C	probably damaging	Het
Topaz1	A	G	9: 122,748,535	N170S	possibly damaging	Het
Trav6-3	T	C	14: 53,428,762	M1T	probably null	Het
Trim66	A	G	7: 109,475,879	S392P	probably benign	Het
Ttn	T	C	2: 76,768,811	T10958A	probably damaging	Het
Ubr7	A	G	12: 102,768,235	K256R	probably benign	Het

Other mutations in Focad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Focad	APN	4	88357474	missense	unknown
IGL00562:Focad	APN	4	88348809	missense	unknown
IGL00563:Focad	APN	4	88348809	missense	unknown
IGL00900:Focad	APN	4	88129023	missense	probably damaging	0.99
IGL00984:Focad	APN	4	88344785	missense	unknown
IGL01016:Focad	APN	4	88392015	missense	possibly damaging	0.51
IGL01069:Focad	APN	4	88326146	missense	unknown
IGL01305:Focad	APN	4	88393547	missense	probably benign	0.32
IGL01409:Focad	APN	4	88342305	missense	unknown
IGL01447:Focad	APN	4	88326228	missense	unknown
IGL01521:Focad	APN	4	88410690	makesense	probably null
IGL01672:Focad	APN	4	88360590	critical splice donor site	probably null
IGL01739:Focad	APN	4	88370806	missense	unknown
IGL02082:Focad	APN	4	88230578	nonsense	probably null
IGL02139:Focad	APN	4	88129054	critical splice donor site	probably null
IGL02381:Focad	APN	4	88274090	splice site	probably benign
IGL02898:Focad	APN	4	88391997	missense	probably benign	0.02
certitude	UTSW	4	88178133	missense	probably damaging	1.00
impression	UTSW	4	88278242	missense	unknown
Microscope	UTSW	4	88342204	missense	unknown
Nuance	UTSW	4	88196846	intron	probably benign
Objective	UTSW	4	88401068	nonsense	probably null
ANU22:Focad	UTSW	4	88393547	missense	probably benign	0.32
R0025:Focad	UTSW	4	88408959	missense	probably benign	0.02
R0554:Focad	UTSW	4	88348889	missense	unknown
R0617:Focad	UTSW	4	88121288	unclassified	probably benign
R0688:Focad	UTSW	4	88274213	missense	unknown
R0746:Focad	UTSW	4	88397214	missense	possibly damaging	0.84
R0907:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1109:Focad	UTSW	4	88196747	intron	probably benign
R1136:Focad	UTSW	4	88326180	missense	unknown
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1185:Focad	UTSW	4	88178187	missense	probably benign	0.40
R1412:Focad	UTSW	4	88278261	critical splice donor site	probably null
R1453:Focad	UTSW	4	88357442	critical splice acceptor site	probably null
R1697:Focad	UTSW	4	88408988	missense	probably damaging	0.98
R1739:Focad	UTSW	4	88397891	missense	probably benign	0.05
R1767:Focad	UTSW	4	88357468	missense	unknown
R1827:Focad	UTSW	4	88229383	missense	probably benign	0.03
R1866:Focad	UTSW	4	88407165	missense	possibly damaging	0.92
R1867:Focad	UTSW	4	88178089	missense	probably damaging	0.99
R1929:Focad	UTSW	4	88342212	missense	unknown
R1929:Focad	UTSW	4	88397179	missense	probably benign	0.32
R1937:Focad	UTSW	4	88401081	start codon destroyed	probably null
R1989:Focad	UTSW	4	88232784	critical splice donor site	probably null
R2176:Focad	UTSW	4	88279244	missense	unknown
R2393:Focad	UTSW	4	88121330	missense	probably damaging	0.96
R2431:Focad	UTSW	4	88331027	missense	unknown
R3195:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3196:Focad	UTSW	4	88407351	missense	possibly damaging	0.85
R3730:Focad	UTSW	4	88408925	missense	possibly damaging	0.52
R3772:Focad	UTSW	4	88336161	splice site	probably benign
R4391:Focad	UTSW	4	88185958	missense	probably damaging	1.00
R4491:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4492:Focad	UTSW	4	88359905	critical splice donor site	probably null
R4703:Focad	UTSW	4	88342321	critical splice donor site	probably null
R4788:Focad	UTSW	4	88357469	missense	unknown
R4923:Focad	UTSW	4	88196846	intron	probably benign
R5026:Focad	UTSW	4	88344582	missense	unknown
R5122:Focad	UTSW	4	88407365	critical splice donor site	probably null
R5153:Focad	UTSW	4	88359884	missense	unknown
R5369:Focad	UTSW	4	88121373	splice site	probably benign
R5414:Focad	UTSW	4	88410702	utr 3 prime	probably benign
R5839:Focad	UTSW	4	88196846	intron	probably benign
R5916:Focad	UTSW	4	88357541	missense	unknown
R5953:Focad	UTSW	4	88229335	missense	probably benign	0.01
R5991:Focad	UTSW	4	88401019	missense	possibly damaging	0.91
R6230:Focad	UTSW	4	88342204	missense	unknown
R6247:Focad	UTSW	4	88407140	missense	possibly damaging	0.92
R6324:Focad	UTSW	4	88401068	nonsense	probably null
R6639:Focad	UTSW	4	88278242	missense	unknown
R6802:Focad	UTSW	4	88274203	missense	unknown
R6802:Focad	UTSW	4	88344684	missense	unknown
R6866:Focad	UTSW	4	88403386	missense	probably benign	0.34
R6902:Focad	UTSW	4	88230476	missense	unknown
R6928:Focad	UTSW	4	88348875	missense	unknown
R7036:Focad	UTSW	4	88124637	missense	probably benign	0.05
R7057:Focad	UTSW	4	88274105	missense	unknown
R7077:Focad	UTSW	4	88410677	missense	unknown
R7242:Focad	UTSW	4	88309906	missense	unknown
R7357:Focad	UTSW	4	88229335	missense	probably benign	0.19
R7380:Focad	UTSW	4	88274198	missense	unknown
R7427:Focad	UTSW	4	88368751	missense	unknown
R7582:Focad	UTSW	4	88229378	missense	probably benign	0.00
R7661:Focad	UTSW	4	88303535	missense	unknown
R7688:Focad	UTSW	4	88178133	missense	probably damaging	1.00
R7789:Focad	UTSW	4	88229406	missense	unknown
R7880:Focad	UTSW	4	88401170	missense	unknown
R7887:Focad	UTSW	4	88182616	missense	probably damaging	1.00
R8024:Focad	UTSW	4	88397000	missense	unknown
R8129:Focad	UTSW	4	88232763	missense	unknown
R8369:Focad	UTSW	4	88232668	missense	unknown
X0035:Focad	UTSW	4	88397922	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- CTTGATGCTGATCAGTCACTCTTAC -3'
(R):5'- TGCATGGGAGCTACACCTAC -3'

Sequencing Primer
(F):5'- GAGAACCAGTTTCTTTTCTCAAGTG -3'
(R):5'- ACAGGTACATATATACACTCATCAGG -3'

Posted On

2018-06-06