Incidental Mutation 'R6543:Rsg1'
ID520918
Institutional Source Beutler Lab
Gene Symbol Rsg1
Ensembl Gene ENSMUSG00000073733
Gene NameREM2 and RAB-like small GTPase 1
SynonymsLOC279260, 6330545A04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6543 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141213956-141226756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 141217288 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 50 (V50G)
Ref Sequence ENSEMBL: ENSMUSP00000095422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097813]
Predicted Effect probably benign
Transcript: ENSMUST00000097813
AA Change: V50G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095422
Gene: ENSMUSG00000073733
AA Change: V50G

DomainStartEndE-ValueType
Pfam:Roc 57 179 7.3e-9 PFAM
Pfam:Ras 57 207 4.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151475
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular defects including persistent truncus arteriosus and atrioventricular septal defects, as well as polydactyly and micrognathia. Eye defects, hypoplastic lungs and thymus, and tracheoesophageal anomalies may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Focad T C 4: 88,279,256 S629P unknown Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il20ra G A 10: 19,749,323 A117T probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
Mtor T A 4: 148,545,596 I2250N probably damaging Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prokr2 T A 2: 132,373,899 Q53L probably benign Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Slfn5 T A 11: 82,958,666 probably null Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trav6-3 T C 14: 53,428,762 M1T probably null Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Rsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Rsg1 APN 4 141218653 missense probably benign 0.01
R0488:Rsg1 UTSW 4 141214401 missense probably benign 0.05
R0967:Rsg1 UTSW 4 141219851 missense probably benign 0.01
R1339:Rsg1 UTSW 4 141218548 missense probably damaging 1.00
R1460:Rsg1 UTSW 4 141218212 missense probably damaging 0.97
R3826:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3828:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3829:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R3830:Rsg1 UTSW 4 141218589 missense probably damaging 1.00
R5076:Rsg1 UTSW 4 141217385 missense probably benign 0.00
R5242:Rsg1 UTSW 4 141219847 missense probably damaging 1.00
R5527:Rsg1 UTSW 4 141219992 missense probably damaging 1.00
R5610:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R5677:Rsg1 UTSW 4 141219866 missense probably benign 0.00
R6049:Rsg1 UTSW 4 141218162 missense probably benign 0.18
R7078:Rsg1 UTSW 4 141219848 missense probably benign 0.01
R7483:Rsg1 UTSW 4 141219842 missense probably damaging 1.00
R8046:Rsg1 UTSW 4 141220037 missense probably damaging 1.00
R8169:Rsg1 UTSW 4 141218219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAGCAGTTGACAATGACAAG -3'
(R):5'- GCGAAGTTCTTGTCCCCATC -3'

Sequencing Primer
(F):5'- CTGTGAGATCCTAGAACATCTCTGTG -3'
(R):5'- TCCCATGGAAGGACACCAAGG -3'
Posted On2018-06-06