Incidental Mutation 'R6518:Wdr70'
ID 520921
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene Name WD repeat domain 70
Synonyms 4833422F06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R6518 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 7873055-8099209 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8079337 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 108 (S108R)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000045766
AA Change: S108R
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: S108R

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,266,411 D88G probably damaging Het
Abcc12 A G 8: 86,509,089 Het
Angptl6 T C 9: 20,875,360 H330R probably damaging Het
Asxl3 T A 18: 22,516,340 V462E probably damaging Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
C1ra T A 6: 124,521,575 probably null Het
C2 T A 17: 34,864,118 I426F probably damaging Het
C4b A T 17: 34,734,205 Y1049N probably damaging Het
Cdkn1b T A 6: 134,921,320 M134K probably benign Het
Cenpn A G 8: 116,937,165 D145G possibly damaging Het
Ckap2 A T 8: 22,173,303 I492K probably benign Het
Cog2 G A 8: 124,527,103 W67* probably null Het
Col7a1 T C 9: 108,955,527 F172L unknown Het
Dcaf1 T C 9: 106,835,589 I112T probably damaging Het
Ddx4 T C 13: 112,604,547 I518V probably benign Het
Dnah10 T C 5: 124,758,355 L908P probably damaging Het
Dsg3 T C 18: 20,533,422 Y563H probably benign Het
Gm12394 A G 4: 42,791,750 I794T probably benign Het
Gm16686 A C 4: 88,755,488 probably benign Het
Gpr139 A T 7: 119,144,511 F284I probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ice1 A T 13: 70,606,309 F553I possibly damaging Het
Igkv6-29 T A 6: 70,138,513 Q99L probably damaging Het
Lipt1 A G 1: 37,875,775 N304S probably benign Het
Lmo1 A C 7: 109,143,576 L39R probably damaging Het
Mcc T A 18: 44,661,811 probably benign Het
Mindy3 T C 2: 12,382,129 T74A probably damaging Het
Olfr1507 T C 14: 52,490,620 I115V probably damaging Het
Olfr71 A G 4: 43,706,334 V78A probably benign Het
Olfr96 G T 17: 37,225,268 A48S probably benign Het
Ormdl1 T C 1: 53,308,957 Y153H probably benign Het
Pdzrn3 A T 6: 101,150,514 *1064K probably null Het
Pias1 A G 9: 62,951,860 L113P probably damaging Het
Piezo2 A T 18: 63,106,271 I514N probably damaging Het
Prkd1 T C 12: 50,425,495 T212A probably benign Het
Rnf219 A T 14: 104,479,065 L624H probably damaging Het
Rsph10b A G 5: 143,963,873 Y151C probably damaging Het
Samhd1 G A 2: 157,114,297 T325M possibly damaging Het
Seh1l A G 18: 67,789,449 T291A probably damaging Het
Smim24 A G 10: 81,393,861 M1V probably null Het
Sp140 TTTTTTTTTTTT TTTTTTTTTTTTTTTTT 1: 85,644,570 probably benign Het
Speer3 T G 5: 13,795,448 I165S possibly damaging Het
Timm23 A G 14: 32,201,637 probably null Het
Tmem17 A T 11: 22,517,427 Y75F possibly damaging Het
Tmem86b A T 7: 4,629,609 C85* probably null Het
Try5 A G 6: 41,314,679 F6S probably benign Het
Vmn2r71 G T 7: 85,621,228 C534F probably damaging Het
Vmn2r85 A T 10: 130,429,412 D67E probably benign Het
Wars2 A T 3: 99,216,800 M326L probably benign Het
Zfp677 A G 17: 21,398,130 H483R probably damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8019607 missense probably benign 0.07
IGL01121:Wdr70 APN 15 7873174 missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8079263 missense probably benign 0.33
IGL01801:Wdr70 APN 15 7887324 splice site probably null
IGL01815:Wdr70 APN 15 7887324 splice site probably null
IGL01929:Wdr70 APN 15 7920634 splice site probably null
IGL02150:Wdr70 APN 15 8082546 missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8046482 missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7884302 nonsense probably null
IGL02800:Wdr70 APN 15 8082496 missense probably benign 0.25
IGL02829:Wdr70 APN 15 7976982 missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7884306 missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7884340 missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8035871 missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0462:Wdr70 UTSW 15 8079161 missense probably benign 0.00
R0539:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8035844 missense probably benign 0.01
R1812:Wdr70 UTSW 15 8079179 missense probably benign 0.00
R1863:Wdr70 UTSW 15 7920573 missense probably benign 0.25
R1913:Wdr70 UTSW 15 7884410 missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7887359 nonsense probably null
R4013:Wdr70 UTSW 15 8079214 nonsense probably null
R4015:Wdr70 UTSW 15 8079214 nonsense probably null
R4017:Wdr70 UTSW 15 8079214 nonsense probably null
R4111:Wdr70 UTSW 15 7976991 missense probably benign 0.32
R5241:Wdr70 UTSW 15 8079216 missense probably benign
R5277:Wdr70 UTSW 15 7976984 nonsense probably null
R5306:Wdr70 UTSW 15 7924273 missense probably benign 0.04
R5426:Wdr70 UTSW 15 7922105 missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7884288 missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7887419 splice site probably null
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8079154 splice site probably null
R6139:Wdr70 UTSW 15 8079251 missense probably benign 0.04
R6400:Wdr70 UTSW 15 8042841 missense probably benign 0.32
R6456:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R7036:Wdr70 UTSW 15 7884374 missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7884396 missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7924244 missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7922081 missense probably benign 0.23
R7572:Wdr70 UTSW 15 8035846 missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8079216 missense probably benign
R7886:Wdr70 UTSW 15 8079249 missense probably benign 0.02
R8103:Wdr70 UTSW 15 7977131 missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7887370 missense probably benign 0.03
R8252:Wdr70 UTSW 15 8042856 splice site probably benign
R8869:Wdr70 UTSW 15 8093726 missense probably benign 0.02
R9203:Wdr70 UTSW 15 7873203 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTTAGCAGGAATTTGTTCTC -3'
(R):5'- CTCTCGTAGTGCTTGAACTGC -3'

Sequencing Primer
(F):5'- GCTTAGCAGGAATTTGTTCTCTATAC -3'
(R):5'- CTCGTAGTGCTTGAACTGCAAATC -3'
Posted On 2018-06-06