Incidental Mutation 'R6518:Wdr70'
ID 520921
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene Name WD repeat domain 70
Synonyms 4833422F06Rik
MMRRC Submission 044645-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R6518 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 7902536-8128693 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8108821 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 108 (S108R)
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000045766
AA Change: S108R
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828
AA Change: S108R

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,123,608 (GRCm39) D88G probably damaging Het
Abcc12 A G 8: 87,235,718 (GRCm39) Het
Angptl6 T C 9: 20,786,656 (GRCm39) H330R probably damaging Het
Asxl3 T A 18: 22,649,397 (GRCm39) V462E probably damaging Het
Atp13a2 G C 4: 140,728,165 (GRCm39) R503P possibly damaging Het
C1ra T A 6: 124,498,534 (GRCm39) probably null Het
C2 T A 17: 35,083,094 (GRCm39) I426F probably damaging Het
C4b A T 17: 34,953,179 (GRCm39) Y1049N probably damaging Het
Cdkn1b T A 6: 134,898,283 (GRCm39) M134K probably benign Het
Cenpn A G 8: 117,663,904 (GRCm39) D145G possibly damaging Het
Ckap2 A T 8: 22,663,319 (GRCm39) I492K probably benign Het
Cog2 G A 8: 125,253,842 (GRCm39) W67* probably null Het
Col7a1 T C 9: 108,784,595 (GRCm39) F172L unknown Het
Dcaf1 T C 9: 106,712,788 (GRCm39) I112T probably damaging Het
Ddx4 T C 13: 112,741,081 (GRCm39) I518V probably benign Het
Dnah10 T C 5: 124,835,419 (GRCm39) L908P probably damaging Het
Dsg3 T C 18: 20,666,479 (GRCm39) Y563H probably benign Het
Gm16686 A C 4: 88,673,725 (GRCm39) probably benign Het
Gpr139 A T 7: 118,743,734 (GRCm39) F284I probably damaging Het
Gtf2h3 C T 5: 124,722,360 (GRCm39) T121I probably benign Het
Ice1 A T 13: 70,754,428 (GRCm39) F553I possibly damaging Het
Igkv6-29 T A 6: 70,115,497 (GRCm39) Q99L probably damaging Het
Lipt1 A G 1: 37,914,856 (GRCm39) N304S probably benign Het
Lmo1 A C 7: 108,742,783 (GRCm39) L39R probably damaging Het
Mcc T A 18: 44,794,878 (GRCm39) probably benign Het
Mindy3 T C 2: 12,386,940 (GRCm39) T74A probably damaging Het
Obi1 A T 14: 104,716,501 (GRCm39) L624H probably damaging Het
Or11a4 G T 17: 37,536,159 (GRCm39) A48S probably benign Het
Or13j1 A G 4: 43,706,334 (GRCm39) V78A probably benign Het
Or4e5 T C 14: 52,728,077 (GRCm39) I115V probably damaging Het
Ormdl1 T C 1: 53,348,116 (GRCm39) Y153H probably benign Het
Pdzrn3 A T 6: 101,127,475 (GRCm39) *1064K probably null Het
Pias1 A G 9: 62,859,142 (GRCm39) L113P probably damaging Het
Piezo2 A T 18: 63,239,342 (GRCm39) I514N probably damaging Het
Prkd1 T C 12: 50,472,278 (GRCm39) T212A probably benign Het
Rsph10b A G 5: 143,900,691 (GRCm39) Y151C probably damaging Het
Samhd1 G A 2: 156,956,217 (GRCm39) T325M possibly damaging Het
Seh1l A G 18: 67,922,519 (GRCm39) T291A probably damaging Het
Smim24 A G 10: 81,229,695 (GRCm39) M1V probably null Het
Sp140 TTTTTTTTTTTT TTTTTTTTTTTTTTTTT 1: 85,572,291 (GRCm39) probably benign Het
Spata31f1e A G 4: 42,791,750 (GRCm39) I794T probably benign Het
Speer3 T G 5: 13,845,462 (GRCm39) I165S possibly damaging Het
Timm23 A G 14: 31,923,594 (GRCm39) probably null Het
Tmem17 A T 11: 22,467,427 (GRCm39) Y75F possibly damaging Het
Tmem86b A T 7: 4,632,608 (GRCm39) C85* probably null Het
Try5 A G 6: 41,291,613 (GRCm39) F6S probably benign Het
Vmn2r71 G T 7: 85,270,436 (GRCm39) C534F probably damaging Het
Vmn2r85 A T 10: 130,265,281 (GRCm39) D67E probably benign Het
Wars2 A T 3: 99,124,116 (GRCm39) M326L probably benign Het
Zfp677 A G 17: 21,618,392 (GRCm39) H483R probably damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8,049,088 (GRCm39) missense probably benign 0.07
IGL01121:Wdr70 APN 15 7,902,655 (GRCm39) missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8,108,747 (GRCm39) missense probably benign 0.33
IGL01801:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01815:Wdr70 APN 15 7,916,805 (GRCm39) splice site probably null
IGL01929:Wdr70 APN 15 7,950,115 (GRCm39) splice site probably null
IGL02150:Wdr70 APN 15 8,112,030 (GRCm39) missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8,075,965 (GRCm39) missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7,913,783 (GRCm39) nonsense probably null
IGL02800:Wdr70 APN 15 8,111,980 (GRCm39) missense probably benign 0.25
IGL02829:Wdr70 APN 15 8,006,463 (GRCm39) missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7,913,787 (GRCm39) missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7,913,821 (GRCm39) missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8,065,352 (GRCm39) missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0106:Wdr70 UTSW 15 8,049,068 (GRCm39) critical splice donor site probably null
R0462:Wdr70 UTSW 15 8,108,645 (GRCm39) missense probably benign 0.00
R0539:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8,065,325 (GRCm39) missense probably benign 0.01
R1812:Wdr70 UTSW 15 8,108,663 (GRCm39) missense probably benign 0.00
R1863:Wdr70 UTSW 15 7,950,054 (GRCm39) missense probably benign 0.25
R1913:Wdr70 UTSW 15 7,913,891 (GRCm39) missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7,916,840 (GRCm39) nonsense probably null
R4013:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4015:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4017:Wdr70 UTSW 15 8,108,698 (GRCm39) nonsense probably null
R4111:Wdr70 UTSW 15 8,006,472 (GRCm39) missense probably benign 0.32
R5241:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R5277:Wdr70 UTSW 15 8,006,465 (GRCm39) nonsense probably null
R5306:Wdr70 UTSW 15 7,953,754 (GRCm39) missense probably benign 0.04
R5426:Wdr70 UTSW 15 7,951,586 (GRCm39) missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7,913,769 (GRCm39) missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7,916,900 (GRCm39) splice site probably null
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7,916,830 (GRCm39) missense possibly damaging 0.86
R6109:Wdr70 UTSW 15 8,108,638 (GRCm39) splice site probably null
R6139:Wdr70 UTSW 15 8,108,735 (GRCm39) missense probably benign 0.04
R6400:Wdr70 UTSW 15 8,072,322 (GRCm39) missense probably benign 0.32
R6456:Wdr70 UTSW 15 7,915,118 (GRCm39) missense possibly damaging 0.96
R7036:Wdr70 UTSW 15 7,913,855 (GRCm39) missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7,913,877 (GRCm39) missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7,953,725 (GRCm39) missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7,951,562 (GRCm39) missense probably benign 0.23
R7572:Wdr70 UTSW 15 8,065,327 (GRCm39) missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8,108,700 (GRCm39) missense probably benign
R7886:Wdr70 UTSW 15 8,108,733 (GRCm39) missense probably benign 0.02
R8103:Wdr70 UTSW 15 8,006,612 (GRCm39) missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7,916,851 (GRCm39) missense probably benign 0.03
R8252:Wdr70 UTSW 15 8,072,337 (GRCm39) splice site probably benign
R8869:Wdr70 UTSW 15 8,123,210 (GRCm39) missense probably benign 0.02
R9203:Wdr70 UTSW 15 7,902,684 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTTAGCAGGAATTTGTTCTC -3'
(R):5'- CTCTCGTAGTGCTTGAACTGC -3'

Sequencing Primer
(F):5'- GCTTAGCAGGAATTTGTTCTCTATAC -3'
(R):5'- CTCGTAGTGCTTGAACTGCAAATC -3'
Posted On 2018-06-06