Incidental Mutation 'R6519:Dclre1c'
ID520944
Institutional Source Beutler Lab
Gene Symbol Dclre1c
Ensembl Gene ENSMUSG00000026648
Gene NameDNA cross-link repair 1C
SynonymsArtemis, Art, 9930121L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location3424131-3464130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3429329 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 75 (Y75H)
Ref Sequence ENSEMBL: ENSMUSP00000100053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000102988] [ENSMUST00000115066]
Predicted Effect probably damaging
Transcript: ENSMUST00000061852
AA Change: Y75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648
AA Change: Y75H

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100463
AA Change: Y75H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648
AA Change: Y75H

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102988
AA Change: Y75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100053
Gene: ENSMUSG00000026648
AA Change: Y75H

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 8.8e-23 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
internal_repeat_1 518 534 4.97e-8 PROSPERO
internal_repeat_1 525 541 4.97e-8 PROSPERO
low complexity region 545 559 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115066
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146027
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Dclre1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Dclre1c APN 2 3433784 nonsense probably null
IGL02165:Dclre1c APN 2 3450381 splice site probably benign
IGL02955:Dclre1c APN 2 3438052 missense probably damaging 1.00
IGL02961:Dclre1c APN 2 3437033 missense probably damaging 1.00
Chairy UTSW 2 3452863 missense probably damaging 1.00
kiwis UTSW 2 3436475 missense probably damaging 1.00
kleiner UTSW 2 3424236 nonsense probably null
pee-wee UTSW 2 3437705 missense probably damaging 1.00
western_woods UTSW 2 3453169 missense possibly damaging 0.68
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0520:Dclre1c UTSW 2 3436475 missense probably damaging 1.00
R1922:Dclre1c UTSW 2 3440782 missense possibly damaging 0.95
R1994:Dclre1c UTSW 2 3437985 missense probably damaging 1.00
R4418:Dclre1c UTSW 2 3452935 missense possibly damaging 0.82
R4420:Dclre1c UTSW 2 3433745 critical splice acceptor site probably null
R4710:Dclre1c UTSW 2 3440861 critical splice donor site probably null
R5789:Dclre1c UTSW 2 3437956 missense probably damaging 1.00
R6113:Dclre1c UTSW 2 3452863 missense probably damaging 1.00
R6148:Dclre1c UTSW 2 3437705 missense probably damaging 1.00
R6964:Dclre1c UTSW 2 3453169 missense possibly damaging 0.68
R7785:Dclre1c UTSW 2 3424236 nonsense probably null
R8111:Dclre1c UTSW 2 3447148 missense probably benign 0.00
Z1088:Dclre1c UTSW 2 3438080 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCACTGTCAGATTGTTGTCAAC -3'
(R):5'- TGAGTCACACCTCAGACACTATTC -3'

Sequencing Primer
(F):5'- ACTGTCAGATTGTTGTCAACTGATTG -3'
(R):5'- CACCTCAGACACTATTCTAATTCATG -3'
Posted On2018-06-06