Incidental Mutation 'R6519:Olfr32'
ID520946
Institutional Source Beutler Lab
Gene Symbol Olfr32
Ensembl Gene ENSMUSG00000075066
Gene Nameolfactory receptor 32
SynonymsMOR227-9_p, GA_x6K02T2Q125-51573576-51572650, MOR227-7P, MTPCR05
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90136273-90142296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90138812 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 109 (I109N)
Ref Sequence ENSEMBL: ENSMUSP00000149175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099755] [ENSMUST00000213293] [ENSMUST00000214973] [ENSMUST00000215153] [ENSMUST00000215659] [ENSMUST00000215765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099755
AA Change: I109N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097344
Gene: ENSMUSG00000075066
AA Change: I109N

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.7e-52 PFAM
Pfam:7tm_1 38 284 6.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213293
AA Change: I109N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214973
AA Change: I109N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215153
AA Change: I109N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215659
AA Change: I109N

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215765
AA Change: I109N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Olfr32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Olfr32 APN 2 90139074 missense probably benign 0.30
IGL01976:Olfr32 APN 2 90138924 missense probably damaging 1.00
IGL02076:Olfr32 APN 2 90138815 missense probably damaging 1.00
IGL03030:Olfr32 APN 2 90138662 missense possibly damaging 0.93
IGL03235:Olfr32 APN 2 90139070 missense possibly damaging 0.88
IGL03410:Olfr32 APN 2 90139145 start gained probably benign
R1240:Olfr32 UTSW 2 90138813 missense possibly damaging 0.48
R1511:Olfr32 UTSW 2 90138404 missense probably benign 0.13
R1602:Olfr32 UTSW 2 90139055 missense probably damaging 1.00
R1828:Olfr32 UTSW 2 90138587 missense probably damaging 0.99
R2023:Olfr32 UTSW 2 90138856 nonsense probably null
R2177:Olfr32 UTSW 2 90138464 missense possibly damaging 0.70
R2679:Olfr32 UTSW 2 90138545 missense possibly damaging 0.93
R4490:Olfr32 UTSW 2 90138917 missense probably damaging 0.97
R4585:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4586:Olfr32 UTSW 2 90138214 missense probably benign 0.01
R4649:Olfr32 UTSW 2 90139088 missense probably damaging 0.99
R4688:Olfr32 UTSW 2 90138999 missense possibly damaging 0.80
R4694:Olfr32 UTSW 2 90138249 nonsense probably null
R5245:Olfr32 UTSW 2 90138262 missense probably damaging 1.00
R5509:Olfr32 UTSW 2 90138892 missense probably damaging 1.00
R5991:Olfr32 UTSW 2 90138234 nonsense probably null
R6004:Olfr32 UTSW 2 90138999 missense probably benign 0.32
R6128:Olfr32 UTSW 2 90138610 nonsense probably null
R7472:Olfr32 UTSW 2 90138324 missense probably damaging 1.00
R7892:Olfr32 UTSW 2 90138492 missense probably benign 0.00
R8017:Olfr32 UTSW 2 90138826 missense probably benign 0.02
R8046:Olfr32 UTSW 2 90138815 missense probably damaging 1.00
R8464:Olfr32 UTSW 2 90138603 missense possibly damaging 0.67
R8712:Olfr32 UTSW 2 90138770 missense probably damaging 1.00
X0066:Olfr32 UTSW 2 90138390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAATCACATTGGGACCACAG -3'
(R):5'- TGGCCTCATTGTTGTGACAG -3'

Sequencing Primer
(F):5'- TCACATTGGGACCACAGAAAGG -3'
(R):5'- AGTAAGAGTCTGTATTCCCCCATG -3'
Posted On2018-06-06