Incidental Mutation 'R6519:Nup160'
ID520948
Institutional Source Beutler Lab
Gene Symbol Nup160
Ensembl Gene ENSMUSG00000051329
Gene Namenucleoporin 160
SynonymsGtl1-13, 2810011M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90677215-90736328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 90718217 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1037 (R1037S)
Ref Sequence ENSEMBL: ENSMUSP00000059289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057481]
Predicted Effect probably damaging
Transcript: ENSMUST00000057481
AA Change: R1037S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: R1037S

DomainStartEndE-ValueType
Pfam:Nup160 28 543 9.9e-134 PFAM
low complexity region 695 710 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1302 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132595
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Nup160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nup160 APN 2 90693106 missense probably damaging 1.00
IGL00938:Nup160 APN 2 90732827 missense probably damaging 1.00
IGL01111:Nup160 APN 2 90733209 missense probably benign 0.00
IGL01140:Nup160 APN 2 90700565 missense possibly damaging 0.85
IGL01348:Nup160 APN 2 90700428 missense probably benign 0.05
IGL01361:Nup160 APN 2 90684012 nonsense probably null
IGL01595:Nup160 APN 2 90729737 missense probably damaging 1.00
IGL01791:Nup160 APN 2 90703853 missense probably damaging 1.00
IGL02058:Nup160 APN 2 90729707 missense probably damaging 1.00
IGL02147:Nup160 APN 2 90703941 missense probably benign 0.17
IGL02250:Nup160 APN 2 90708870 missense probably damaging 1.00
IGL02507:Nup160 APN 2 90729735 missense probably benign 0.08
IGL03108:Nup160 APN 2 90703825 missense probably benign
R0031:Nup160 UTSW 2 90717587 splice site probably null
R0365:Nup160 UTSW 2 90708844 missense probably benign 0.01
R0417:Nup160 UTSW 2 90735427 missense possibly damaging 0.93
R0781:Nup160 UTSW 2 90733219 splice site probably benign
R1037:Nup160 UTSW 2 90693902 missense probably damaging 1.00
R1110:Nup160 UTSW 2 90733219 splice site probably benign
R1459:Nup160 UTSW 2 90690150 missense probably damaging 1.00
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1478:Nup160 UTSW 2 90679399 start gained probably benign
R1565:Nup160 UTSW 2 90722061 missense possibly damaging 0.62
R1617:Nup160 UTSW 2 90679499 missense probably benign
R1647:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1648:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1702:Nup160 UTSW 2 90683958 missense probably damaging 0.96
R1719:Nup160 UTSW 2 90700436 nonsense probably null
R2448:Nup160 UTSW 2 90722057 missense probably damaging 1.00
R3775:Nup160 UTSW 2 90722076 missense probably benign
R3776:Nup160 UTSW 2 90722076 missense probably benign
R4600:Nup160 UTSW 2 90685197 critical splice donor site probably null
R4812:Nup160 UTSW 2 90725691 missense probably damaging 1.00
R5075:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R5309:Nup160 UTSW 2 90732832 nonsense probably null
R5312:Nup160 UTSW 2 90732832 nonsense probably null
R5447:Nup160 UTSW 2 90725615 missense possibly damaging 0.82
R5682:Nup160 UTSW 2 90679811 missense probably benign 0.29
R5726:Nup160 UTSW 2 90717851 missense probably damaging 1.00
R5771:Nup160 UTSW 2 90723396 missense probably damaging 1.00
R5825:Nup160 UTSW 2 90679770 critical splice acceptor site probably null
R5851:Nup160 UTSW 2 90707038 missense probably benign
R5988:Nup160 UTSW 2 90689209 missense probably damaging 1.00
R6151:Nup160 UTSW 2 90690105 nonsense probably null
R6164:Nup160 UTSW 2 90717876 nonsense probably null
R6356:Nup160 UTSW 2 90711935 splice site probably null
R6379:Nup160 UTSW 2 90702409 nonsense probably null
R6755:Nup160 UTSW 2 90700456 missense probably damaging 1.00
R6989:Nup160 UTSW 2 90707020 missense probably benign 0.34
R7251:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R7256:Nup160 UTSW 2 90723355 missense probably damaging 1.00
R7353:Nup160 UTSW 2 90703952 missense probably damaging 0.99
R7546:Nup160 UTSW 2 90685058 missense probably damaging 1.00
R7761:Nup160 UTSW 2 90703112 missense probably benign
R7768:Nup160 UTSW 2 90700116 missense probably damaging 1.00
R7959:Nup160 UTSW 2 90713895 critical splice donor site probably null
R8525:Nup160 UTSW 2 90718096 critical splice donor site probably null
R8726:Nup160 UTSW 2 90733201 missense possibly damaging 0.86
R8745:Nup160 UTSW 2 90700119 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCCAACTGCAGGATCTTGTAGAG -3'
(R):5'- CACTTGAAAATGTTATGAGAGCCC -3'

Sequencing Primer
(F):5'- CAACTGCAGGATCTTGTAGAGTTTCC -3'
(R):5'- GCTGCTTTTACCACCAAG -3'
Posted On2018-06-06