Incidental Mutation 'R6543:Il20ra'
ID 520949
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6543 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 19712570-19760053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 19749323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 117 (A117T)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect probably damaging
Transcript: ENSMUST00000020185
AA Change: A117T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: A117T

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
MGI Phenotype Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Focad T C 4: 88,279,256 S629P unknown Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
Mtor T A 4: 148,545,596 I2250N probably damaging Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prokr2 T A 2: 132,373,899 Q53L probably benign Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Rsg1 T G 4: 141,217,288 V50G probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Slfn5 T A 11: 82,958,666 probably null Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trav6-3 T C 14: 53,428,762 M1T probably null Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19759271 missense probably benign 0.01
IGL01936:Il20ra APN 10 19755843 missense probably damaging 1.00
IGL01958:Il20ra APN 10 19759043 missense probably benign 0.39
IGL02109:Il20ra APN 10 19759505 missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19751578 missense probably damaging 0.99
IGL02234:Il20ra APN 10 19749270 missense probably damaging 1.00
IGL02959:Il20ra APN 10 19759041 missense probably benign 0.10
IGL03010:Il20ra APN 10 19749212 missense probably damaging 1.00
P0017:Il20ra UTSW 10 19759406 missense probably damaging 1.00
R0518:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R0521:Il20ra UTSW 10 19759640 missense probably damaging 1.00
R1436:Il20ra UTSW 10 19749252 missense probably damaging 1.00
R1714:Il20ra UTSW 10 19755828 missense probably damaging 0.98
R1792:Il20ra UTSW 10 19759636 missense probably damaging 0.99
R1852:Il20ra UTSW 10 19743019 missense probably damaging 1.00
R2097:Il20ra UTSW 10 19759463 missense probably damaging 1.00
R4559:Il20ra UTSW 10 19749284 missense probably damaging 0.99
R4970:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5112:Il20ra UTSW 10 19758943 missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19749359 missense probably damaging 0.99
R6755:Il20ra UTSW 10 19750794 missense probably benign 0.15
R6845:Il20ra UTSW 10 19759311 missense probably benign 0.06
R7014:Il20ra UTSW 10 19712710 missense unknown
R7190:Il20ra UTSW 10 19742941 missense probably damaging 0.99
R8134:Il20ra UTSW 10 19750704 missense probably damaging 0.99
R8955:Il20ra UTSW 10 19759412 missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19759616 missense probably benign 0.21
R9439:Il20ra UTSW 10 19743003 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATCTGTGTTTTGCTGAAGAC -3'
(R):5'- GCAGCAGGTCTGGTTATTCAAC -3'

Sequencing Primer
(F):5'- CTGTGTTTTGCTGAAGACAAAGTC -3'
(R):5'- AGGTCTGGTTATTCAACTTGATGTAC -3'
Posted On 2018-06-06