Incidental Mutation 'R6519:Dhx35'
ID520952
Institutional Source Beutler Lab
Gene Symbol Dhx35
Ensembl Gene ENSMUSG00000027655
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 35
Synonyms1200009D07Rik, Ddx35
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location158794807-158858214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158831710 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 354 (I354F)
Ref Sequence ENSEMBL: ENSMUSP00000029186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029186] [ENSMUST00000109478] [ENSMUST00000156893]
Predicted Effect probably damaging
Transcript: ENSMUST00000029186
AA Change: I354F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029186
Gene: ENSMUSG00000027655
AA Change: I354F

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Pfam:OB_NTP_bind 628 660 2.7e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109478
AA Change: I354F

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105104
Gene: ENSMUSG00000027655
AA Change: I354F

DomainStartEndE-ValueType
DEXDc 55 248 1.17e-18 SMART
HELICc 299 398 8.76e-18 SMART
HA2 458 549 1.49e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146797
Predicted Effect probably benign
Transcript: ENSMUST00000156893
SMART Domains Protein: ENSMUSP00000119497
Gene: ENSMUSG00000027655

DomainStartEndE-ValueType
PDB:3LLM|B 7 115 1e-10 PDB
Blast:DEXDc 55 119 5e-37 BLAST
SCOP:d1jpna2 63 115 3e-10 SMART
PDB:3KX2|A 116 204 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157070
Meta Mutation Damage Score 0.8823 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The function of this gene product which is a member of this family, has not been determined. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Dhx35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dhx35 APN 2 158827916 missense probably damaging 1.00
IGL01942:Dhx35 APN 2 158831864 missense probably damaging 1.00
IGL02899:Dhx35 APN 2 158801450 missense probably damaging 1.00
IGL02927:Dhx35 APN 2 158820416 missense probably damaging 1.00
IGL03224:Dhx35 APN 2 158857132 utr 3 prime probably benign
R0112:Dhx35 UTSW 2 158840620 missense probably damaging 0.99
R0200:Dhx35 UTSW 2 158829623 missense probably benign
R0609:Dhx35 UTSW 2 158817415 missense possibly damaging 0.62
R0714:Dhx35 UTSW 2 158844183 missense probably benign
R0884:Dhx35 UTSW 2 158831711 missense probably damaging 0.97
R1775:Dhx35 UTSW 2 158806437 missense probably damaging 1.00
R1912:Dhx35 UTSW 2 158842307 missense probably damaging 0.96
R2136:Dhx35 UTSW 2 158831861 missense probably damaging 1.00
R4094:Dhx35 UTSW 2 158842356 missense probably damaging 1.00
R4364:Dhx35 UTSW 2 158842352 nonsense probably null
R4421:Dhx35 UTSW 2 158806401 missense probably damaging 1.00
R4565:Dhx35 UTSW 2 158849535 missense probably benign 0.01
R5517:Dhx35 UTSW 2 158834912 missense probably damaging 1.00
R5732:Dhx35 UTSW 2 158831785 missense probably damaging 0.99
R5979:Dhx35 UTSW 2 158842869 missense probably benign 0.29
R6054:Dhx35 UTSW 2 158818299 missense probably benign 0.00
R6405:Dhx35 UTSW 2 158794919 missense probably damaging 1.00
R6452:Dhx35 UTSW 2 158831687 missense probably damaging 1.00
R8700:Dhx35 UTSW 2 158840632 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGCATGAGAAAGCAGTGCTC -3'
(R):5'- ACACCATACATACCTGTGTAAAGGC -3'

Sequencing Primer
(F):5'- AACATTTCCGGCCAGTGTG -3'
(R):5'- GTGTAAAGGCGATAACACTTTCCCG -3'
Posted On2018-06-06