Incidental Mutation 'R6519:Dnttip2'
ID520957
Institutional Source Beutler Lab
Gene Symbol Dnttip2
Ensembl Gene ENSMUSG00000039756
Gene Namedeoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms4930588M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location122274388-122285271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122275471 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000045043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029769] [ENSMUST00000035776]
Predicted Effect probably benign
Transcript: ENSMUST00000029769
SMART Domains Protein: ENSMUSP00000029769
Gene: ENSMUSG00000028124

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Pfam:Aldo_ket_red 70 237 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035776
AA Change: S112P

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 125 143 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
coiled coil region 513 541 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Pfam:Fcf2 639 733 3.4e-41 PFAM
low complexity region 748 756 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199627
Meta Mutation Damage Score 0.1542 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Dnttip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Dnttip2 APN 3 122284499 missense probably damaging 1.00
IGL00921:Dnttip2 APN 3 122275290 missense probably benign 0.03
IGL01120:Dnttip2 APN 3 122278737 splice site probably benign
IGL01341:Dnttip2 APN 3 122276612 missense probably damaging 1.00
IGL01636:Dnttip2 APN 3 122282474 missense possibly damaging 0.95
IGL01988:Dnttip2 APN 3 122276295 missense probably benign 0.05
IGL02096:Dnttip2 APN 3 122284413 missense possibly damaging 0.51
IGL02216:Dnttip2 APN 3 122276261 missense probably benign 0.01
IGL03234:Dnttip2 APN 3 122282438 missense probably damaging 1.00
Abyss UTSW 3 122276221 missense probably damaging 0.99
Chasm UTSW 3 122275808 missense probably damaging 1.00
R0089:Dnttip2 UTSW 3 122275462 missense possibly damaging 0.59
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0195:Dnttip2 UTSW 3 122276161 missense probably benign 0.02
R1103:Dnttip2 UTSW 3 122276422 missense probably benign 0.02
R1733:Dnttip2 UTSW 3 122276748 missense probably benign 0.25
R1759:Dnttip2 UTSW 3 122276149 missense probably benign 0.21
R2019:Dnttip2 UTSW 3 122280744 missense possibly damaging 0.93
R2022:Dnttip2 UTSW 3 122276221 missense probably damaging 1.00
R2415:Dnttip2 UTSW 3 122276537 missense probably damaging 1.00
R3913:Dnttip2 UTSW 3 122275391 missense possibly damaging 0.68
R4194:Dnttip2 UTSW 3 122280761 missense probably damaging 1.00
R4367:Dnttip2 UTSW 3 122276497 missense probably damaging 1.00
R4871:Dnttip2 UTSW 3 122285101 missense probably damaging 1.00
R4888:Dnttip2 UTSW 3 122276592 missense probably damaging 1.00
R5082:Dnttip2 UTSW 3 122275941 missense probably damaging 0.98
R5436:Dnttip2 UTSW 3 122278769 missense probably damaging 1.00
R5483:Dnttip2 UTSW 3 122276797 missense probably damaging 0.97
R5933:Dnttip2 UTSW 3 122275568 missense probably benign 0.07
R5966:Dnttip2 UTSW 3 122285168 utr 3 prime probably benign
R6171:Dnttip2 UTSW 3 122278862 missense probably damaging 0.99
R6251:Dnttip2 UTSW 3 122275256 missense probably benign 0.14
R6286:Dnttip2 UTSW 3 122284400 missense probably damaging 1.00
R6512:Dnttip2 UTSW 3 122275523 missense possibly damaging 0.67
R6670:Dnttip2 UTSW 3 122276221 missense probably damaging 0.99
R6833:Dnttip2 UTSW 3 122276803 missense probably damaging 0.99
R6870:Dnttip2 UTSW 3 122275808 missense probably damaging 1.00
R6969:Dnttip2 UTSW 3 122282492 missense probably damaging 1.00
R7038:Dnttip2 UTSW 3 122276532 nonsense probably null
R7233:Dnttip2 UTSW 3 122276390 missense probably benign 0.26
R7423:Dnttip2 UTSW 3 122275526 missense probably benign
R7591:Dnttip2 UTSW 3 122276468 nonsense probably null
R7765:Dnttip2 UTSW 3 122275945 missense probably benign 0.09
R7842:Dnttip2 UTSW 3 122276341 missense probably benign 0.03
R7899:Dnttip2 UTSW 3 122282369 missense probably damaging 1.00
R7925:Dnttip2 UTSW 3 122276341 missense probably benign 0.03
R7982:Dnttip2 UTSW 3 122282369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAAGGAATCGGGATCC -3'
(R):5'- GTTCCCGACTGTGATTCTTGGC -3'

Sequencing Primer
(F):5'- TGAATCGCAGCCTGCTGAG -3'
(R):5'- GGCTTGAATCTCTTTGAGAATTAGCC -3'
Posted On2018-06-06