Incidental Mutation 'R6519:Aldob'
ID520961
Institutional Source Beutler Lab
Gene Symbol Aldob
Ensembl Gene ENSMUSG00000028307
Gene Namealdolase B, fructose-bisphosphate
SynonymsAldo2, Aldo-2
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_144903.2; MGI:87995

Is this an essential gene? Possibly essential (E-score: 0.584) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location49535995-49549546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49543835 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 49 (V49E)
Ref Sequence ENSEMBL: ENSMUSP00000029987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029987]
Predicted Effect probably damaging
Transcript: ENSMUST00000029987
AA Change: V49E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029987
Gene: ENSMUSG00000028307
AA Change: V49E

DomainStartEndE-ValueType
Pfam:Glycolytic 15 364 1.8e-178 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148415
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a subunit of the homotetrameric enzyme aldolase B, an isozyme of the class I fructose 1,6-bisphosphate aldolase enzyme. This enzyme catalyzes the conversion of fructose 1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. Homozygous knockout mice for this gene exhibit liver damage and death following fructose ingestion. A pseudogene of this gene has been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Following exposure to a 40% fructose diet, mice homozygous for a null allele exhibit failure to thrive, liver pathology and dysfunction, and a high mortality rate. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Aldob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Aldob APN 4 49536843 missense probably benign 0.01
IGL00774:Aldob APN 4 49536843 missense probably benign 0.01
IGL00976:Aldob APN 4 49541220 missense probably damaging 1.00
IGL02118:Aldob APN 4 49538790 nonsense probably null
IGL02494:Aldob APN 4 49541138 missense possibly damaging 0.92
IGL03001:Aldob APN 4 49542844 missense probably damaging 1.00
despondent UTSW 4 49539789 missense probably damaging 1.00
Saddened UTSW 4 49538796 missense probably benign
P0014:Aldob UTSW 4 49538153 missense probably benign 0.34
R0046:Aldob UTSW 4 49543842 missense possibly damaging 0.83
R0046:Aldob UTSW 4 49543842 missense possibly damaging 0.83
R1770:Aldob UTSW 4 49536861 missense probably damaging 1.00
R1867:Aldob UTSW 4 49543835 missense possibly damaging 0.84
R1975:Aldob UTSW 4 49538171 missense probably benign 0.06
R6858:Aldob UTSW 4 49538796 missense probably benign
R6897:Aldob UTSW 4 49539789 missense probably damaging 1.00
R7106:Aldob UTSW 4 49541258 missense probably damaging 1.00
R7846:Aldob UTSW 4 49538858 missense probably damaging 1.00
R8195:Aldob UTSW 4 49538822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGCCCACCACAATTCC -3'
(R):5'- TTTCCCAGTCATCAGTCTTAGAGC -3'

Sequencing Primer
(F):5'- ACAATTCCCTTCTCCTTGAGAACG -3'
(R):5'- GTCATCAGTCTTAGAGCAACTACTG -3'
Posted On2018-06-06