Incidental Mutation 'R6543:Slfn5'
ID520962
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6543 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 82958666 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect probably null
Transcript: ENSMUST00000067443
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108157
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108158
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216469
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Focad T C 4: 88,279,256 S629P unknown Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il20ra G A 10: 19,749,323 A117T probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
Mtor T A 4: 148,545,596 I2250N probably damaging Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prokr2 T A 2: 132,373,899 Q53L probably benign Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Rsg1 T G 4: 141,217,288 V50G probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trav6-3 T C 14: 53,428,762 M1T probably null Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5498:Slfn5 UTSW 11 82957147 missense possibly damaging 0.84
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACCATTGACCGTCACATTTTC -3'
(R):5'- CAACCTGTTCCAAAGTGGCC -3'

Sequencing Primer
(F):5'- ATTGACCGTCACATTTTCTATTCAC -3'
(R):5'- TGTTCCAAAGTGGCCAGAAAC -3'
Posted On2018-06-06