Incidental Mutation 'R6543:Trav6-3'
ID520966
Institutional Source Beutler Lab
Gene Symbol Trav6-3
Ensembl Gene ENSMUSG00000094220
Gene NameT cell receptor alpha variable 6-3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6543 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location53428711-53430375 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 53428762 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000137964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180549] [ENSMUST00000183604]
Predicted Effect probably null
Transcript: ENSMUST00000180549
AA Change: M1T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137964
Gene: ENSMUSG00000094220
AA Change: M1T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:V-set 21 112 7.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183604
SMART Domains Protein: ENSMUSP00000138968
Gene: ENSMUSG00000094220

DomainStartEndE-ValueType
Pfam:V-set 10 101 4.6e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4e1 T C 2: 127,066,605 V1091A probably benign Het
Arhgef11 A G 3: 87,733,408 N1320D probably benign Het
Atl3 T A 19: 7,510,098 F126Y probably damaging Het
Borcs5 C T 6: 134,710,180 T167M probably damaging Het
Creld2 A G 15: 88,825,278 T331A probably benign Het
Cuzd1 A G 7: 131,309,768 V494A probably damaging Het
Dclk1 C T 3: 55,500,131 P244S probably damaging Het
Esyt3 T C 9: 99,338,772 N126S possibly damaging Het
Focad T C 4: 88,279,256 S629P unknown Het
Gm11236 A G 4: 73,638,978 E16G probably damaging Het
Gm17660 T C 5: 104,074,875 probably benign Het
Grip1 T C 10: 119,985,594 L389P probably benign Het
Igkv4-91 A T 6: 68,768,598 D105E probably damaging Het
Il20ra G A 10: 19,749,323 A117T probably damaging Het
Il6ra A G 3: 89,876,863 V367A probably damaging Het
Itga8 C T 2: 12,301,644 V47M probably damaging Het
Limk2 T C 11: 3,350,682 Y220C probably damaging Het
Lims1 T A 10: 58,412,451 C243* probably null Het
Man1a C A 10: 53,934,981 G435* probably null Het
Mtor T A 4: 148,545,596 I2250N probably damaging Het
N4bp1 G A 8: 86,861,906 Q135* probably null Het
Nbeal2 A T 9: 110,644,458 D76E probably benign Het
Nbn T C 4: 15,986,605 S669P probably benign Het
Nfrkb C T 9: 31,400,985 Q456* probably null Het
Olfr803 C A 10: 129,691,990 G17V probably benign Het
Pcnx3 C T 19: 5,665,247 A1557T probably benign Het
Pgd C T 4: 149,160,752 probably null Het
Prokr2 T A 2: 132,373,899 Q53L probably benign Het
Pxmp4 C A 2: 154,588,059 A137S possibly damaging Het
Rasef C T 4: 73,780,519 probably benign Het
Rsg1 T G 4: 141,217,288 V50G probably benign Het
Scrt2 C T 2: 152,093,143 A72V probably benign Het
Sipa1l2 T C 8: 125,450,362 E1171G possibly damaging Het
Slc26a8 T C 17: 28,638,401 T923A possibly damaging Het
Slco1a6 T C 6: 142,133,146 K141R probably benign Het
Slfn5 T A 11: 82,958,666 probably null Het
Sympk A T 7: 19,036,830 H282L probably damaging Het
Tnr A G 1: 159,924,107 Y1324C probably damaging Het
Topaz1 A G 9: 122,748,535 N170S possibly damaging Het
Trim66 A G 7: 109,475,879 S392P probably benign Het
Ttn T C 2: 76,768,811 T10958A probably damaging Het
Ubr7 A G 12: 102,768,235 K256R probably benign Het
Other mutations in Trav6-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Trav6-3 APN 14 53430343 missense probably benign 0.01
R4079:Trav6-3 UTSW 14 53430080 missense possibly damaging 0.89
R4513:Trav6-3 UTSW 14 53430091 missense probably benign 0.01
R5851:Trav6-3 UTSW 14 53430115 missense probably benign 0.03
R5864:Trav6-3 UTSW 14 53430171 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGGTGTTACAATAGACCCTAG -3'
(R):5'- GCTTAAATCCCACTTAGAATGGG -3'

Sequencing Primer
(F):5'- AGTTTAGTTTCTGTCCACCAGG -3'
(R):5'- CCCACTTAGAATGGGGAATAAAATAG -3'
Posted On2018-06-06