Incidental Mutation 'R6519:Kcnab2'
ID520973
Institutional Source Beutler Lab
Gene Symbol Kcnab2
Ensembl Gene ENSMUSG00000028931
Gene Namepotassium voltage-gated channel, shaker-related subfamily, beta member 2
SynonymsKcnb3, I2rf5, F5, I2rf5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location152390742-152477871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152411993 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 65 (T65A)
Ref Sequence ENSEMBL: ENSMUSP00000125270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030768] [ENSMUST00000105648] [ENSMUST00000159186] [ENSMUST00000159840] [ENSMUST00000160884] [ENSMUST00000161236]
Predicted Effect probably benign
Transcript: ENSMUST00000030768
AA Change: T51A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030768
Gene: ENSMUSG00000028931
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105648
AA Change: T65A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000101273
Gene: ENSMUSG00000028931
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159186
AA Change: T65A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124588
Gene: ENSMUSG00000028931
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 371 4.3e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159435
Predicted Effect probably benign
Transcript: ENSMUST00000159840
AA Change: T51A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124156
Gene: ENSMUSG00000028931
AA Change: T51A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 37 342 1.6e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159844
Predicted Effect probably benign
Transcript: ENSMUST00000160884
AA Change: T65A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125058
Gene: ENSMUSG00000028931
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 356 7e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161236
AA Change: T65A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125270
Gene: ENSMUSG00000028931
AA Change: T65A

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 51 134 4.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162200
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice show strain-specific changes in survival, body weight, thermoregulation and cold-swim induced tremors, impaired associative learning and memory, sporadic seizures and amygala hyperexcitability. Mice homozygous for a knock-in mutationshow no deficits in associative learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Kcnab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Kcnab2 APN 4 152393797 missense possibly damaging 0.94
IGL02201:Kcnab2 APN 4 152401918 unclassified probably benign
IGL02449:Kcnab2 APN 4 152411984 critical splice donor site probably null
IGL02957:Kcnab2 APN 4 152435869 missense possibly damaging 0.62
R0415:Kcnab2 UTSW 4 152395136 missense probably benign 0.39
R0485:Kcnab2 UTSW 4 152394982 missense probably benign
R1759:Kcnab2 UTSW 4 152393052 missense probably damaging 0.99
R1933:Kcnab2 UTSW 4 152435866 missense possibly damaging 0.66
R3037:Kcnab2 UTSW 4 152393756 missense possibly damaging 0.94
R3913:Kcnab2 UTSW 4 152395232 missense probably damaging 0.99
R4178:Kcnab2 UTSW 4 152404601 missense probably null 1.00
R4863:Kcnab2 UTSW 4 152401946 missense probably damaging 1.00
R4919:Kcnab2 UTSW 4 152401940 missense probably damaging 1.00
R5996:Kcnab2 UTSW 4 152434830 splice site probably null
R7753:Kcnab2 UTSW 4 152396761 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGCTTGCTAGATAGTGCCAC -3'
(R):5'- TATCTGGAGACTCACCCTGG -3'

Sequencing Primer
(F):5'- ACTGGGCACAACTTTCCC -3'
(R):5'- TCACCCTGGAGGCTAAGTAC -3'
Posted On2018-06-06