Incidental Mutation 'R6544:Sox17'
ID520976
Institutional Source Beutler Lab
Gene Symbol Sox17
Ensembl Gene ENSMUSG00000025902
Gene NameSRY (sex determining region Y)-box 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location4490931-4497354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 4492432 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 117 (P117T)
Ref Sequence ENSEMBL: ENSMUSP00000142116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027035] [ENSMUST00000116652] [ENSMUST00000191647] [ENSMUST00000191939] [ENSMUST00000192650] [ENSMUST00000192913] [ENSMUST00000195555]
Predicted Effect probably benign
Transcript: ENSMUST00000027035
AA Change: P182T

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027035
Gene: ENSMUSG00000025902
AA Change: P182T

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 417 9.5e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116652
AA Change: P182T

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112351
Gene: ENSMUSG00000025902
AA Change: P182T

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 330 9.8e-19 PFAM
Pfam:Sox_C_TAD 312 418 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191647
SMART Domains Protein: ENSMUSP00000142204
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 3.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191939
SMART Domains Protein: ENSMUSP00000142154
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192505
Predicted Effect possibly damaging
Transcript: ENSMUST00000192650
AA Change: P117T

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142116
Gene: ENSMUSG00000025902
AA Change: P117T

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 2.5e-7 PFAM
low complexity region 117 128 N/A INTRINSIC
Pfam:Sox_C_TAD 132 266 6.1e-16 PFAM
Pfam:Sox_C_TAD 255 353 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192913
SMART Domains Protein: ENSMUSP00000141674
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193450
Predicted Effect probably benign
Transcript: ENSMUST00000195555
AA Change: P54T

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141894
Gene: ENSMUSG00000025902
AA Change: P54T

DomainStartEndE-ValueType
SCOP:d2lefa_ 1 21 6e-4 SMART
low complexity region 54 65 N/A INTRINSIC
Pfam:Sox_C_TAD 69 202 4.6e-16 PFAM
Pfam:Sox_C_TAD 192 290 3.1e-27 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation develop a deficient gut endoderm and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Sox17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sox17 APN 1 4492203 missense possibly damaging 0.66
rheas UTSW 1 4492432 missense possibly damaging 0.71
R1160:Sox17 UTSW 1 4491852 missense probably damaging 1.00
R1503:Sox17 UTSW 1 4491928 missense probably damaging 1.00
R2911:Sox17 UTSW 1 4493131 missense probably damaging 1.00
R3004:Sox17 UTSW 1 4492617 missense probably damaging 1.00
R3508:Sox17 UTSW 1 4492155 missense probably damaging 0.98
R4596:Sox17 UTSW 1 4492637 missense possibly damaging 0.91
R5274:Sox17 UTSW 1 4491888 missense possibly damaging 0.74
R7496:Sox17 UTSW 1 4492327 missense probably damaging 0.96
R7704:Sox17 UTSW 1 4493672 intron probably benign
Z1088:Sox17 UTSW 1 4492302 missense probably damaging 1.00
Z1177:Sox17 UTSW 1 4492473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCATAGTCCGAGACTG -3'
(R):5'- TTGACCTTGGCAGAGAAGC -3'

Sequencing Primer
(F):5'- CATAGTCCGAGACTGGAGCG -3'
(R):5'- CTTCGTGGAAGAGGCCGAG -3'
Posted On2018-06-06