Incidental Mutation 'R6519:BC037034'
ID520977
Institutional Source Beutler Lab
Gene Symbol BC037034
Ensembl Gene ENSMUSG00000036948
Gene NamecDNA sequence BC037034
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138259656-138264033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 138261848 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 344 (S344P)
Ref Sequence ENSEMBL: ENSMUSP00000046898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048421] [ENSMUST00000062067] [ENSMUST00000100530] [ENSMUST00000159067] [ENSMUST00000159123] [ENSMUST00000159146] [ENSMUST00000159649] [ENSMUST00000161647] [ENSMUST00000161279]
Predicted Effect probably damaging
Transcript: ENSMUST00000048421
AA Change: S344P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046898
Gene: ENSMUSG00000036948
AA Change: S344P

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
low complexity region 215 225 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062067
Predicted Effect probably benign
Transcript: ENSMUST00000100530
SMART Domains Protein: ENSMUSP00000098099
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144460
Predicted Effect probably benign
Transcript: ENSMUST00000159067
SMART Domains Protein: ENSMUSP00000125178
Gene: ENSMUSG00000106247

DomainStartEndE-ValueType
Pfam:Glypican 7 250 1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159123
SMART Domains Protein: ENSMUSP00000137679
Gene: ENSMUSG00000036948

DomainStartEndE-ValueType
low complexity region 53 71 N/A INTRINSIC
low complexity region 75 93 N/A INTRINSIC
low complexity region 95 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159534
Predicted Effect probably damaging
Transcript: ENSMUST00000159649
AA Change: S75P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125208
Gene: ENSMUSG00000036948
AA Change: S75P

DomainStartEndE-ValueType
low complexity region 219 233 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161647
SMART Domains Protein: ENSMUSP00000125084
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 4 226 5.3e-58 PFAM
Pfam:Gal-3-0_sulfotr 265 458 3.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162632
Predicted Effect probably benign
Transcript: ENSMUST00000161279
SMART Domains Protein: ENSMUSP00000124841
Gene: ENSMUSG00000075593

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 2 231 1.1e-57 PFAM
Pfam:Gal-3-0_sulfotr 270 463 1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162557
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Txnrd3 T C 6: 89,654,423 probably null Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in BC037034
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:BC037034 APN 5 138261705 missense possibly damaging 0.46
IGL01617:BC037034 APN 5 138262216 missense probably damaging 1.00
IGL02256:BC037034 APN 5 138260315 missense probably damaging 0.99
IGL02493:BC037034 APN 5 138263170 splice site probably null
IGL02904:BC037034 APN 5 138260602 missense probably benign 0.04
IGL03151:BC037034 APN 5 138262672 missense possibly damaging 0.95
R0005:BC037034 UTSW 5 138262654 splice site probably null
R0010:BC037034 UTSW 5 138260293 splice site probably null
R0010:BC037034 UTSW 5 138260293 splice site probably null
R0619:BC037034 UTSW 5 138263826 unclassified probably benign
R0630:BC037034 UTSW 5 138262289 missense probably damaging 0.98
R1579:BC037034 UTSW 5 138261866 missense probably benign 0.00
R1778:BC037034 UTSW 5 138262477 splice site probably null
R1816:BC037034 UTSW 5 138260341 missense possibly damaging 0.91
R2009:BC037034 UTSW 5 138260929 missense probably damaging 1.00
R4711:BC037034 UTSW 5 138262905 unclassified probably benign
R4923:BC037034 UTSW 5 138262379 unclassified probably benign
R4999:BC037034 UTSW 5 138261622 missense probably damaging 1.00
R5103:BC037034 UTSW 5 138262300 missense probably benign 0.15
R5221:BC037034 UTSW 5 138262240 missense probably benign 0.14
R5444:BC037034 UTSW 5 138260998 splice site probably null
R5720:BC037034 UTSW 5 138263702 missense probably benign 0.00
R6599:BC037034 UTSW 5 138263458 splice site probably null
R6918:BC037034 UTSW 5 138260664 missense probably benign 0.03
R7275:BC037034 UTSW 5 138263577 missense probably benign 0.18
R7460:BC037034 UTSW 5 138262729 missense probably benign 0.32
R7564:BC037034 UTSW 5 138262842 splice site probably null
R8745:BC037034 UTSW 5 138263065 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCATCACAAAGCAGGGGC -3'
(R):5'- TGAGCTGGTGTGATCACAG -3'

Sequencing Primer
(F):5'- CGGTCTAGGCGGACACTG -3'
(R):5'- AGCATAGAGTCCAGGGTTCTACC -3'
Posted On2018-06-06