Incidental Mutation 'R6544:Serpine2'
ID520978
Institutional Source Beutler Lab
Gene Symbol Serpine2
Ensembl Gene ENSMUSG00000026249
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 2
Synonymsprotease nexin 1, Spi4, B230326M24Rik, nexin, PN-1, PI7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6544 (G1)
Quality Score180.009
Status Validated
Chromosome1
Chromosomal Location79794197-79861180 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 79803130 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027467] [ENSMUST00000189793] [ENSMUST00000190724]
Predicted Effect probably null
Transcript: ENSMUST00000027467
SMART Domains Protein: ENSMUSP00000027467
Gene: ENSMUSG00000026249

DomainStartEndE-ValueType
SERPIN 36 397 9.93e-152 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189793
SMART Domains Protein: ENSMUSP00000140065
Gene: ENSMUSG00000026249

DomainStartEndE-ValueType
SERPIN 1 231 2.3e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190724
SMART Domains Protein: ENSMUSP00000140255
Gene: ENSMUSG00000026249

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 36 232 7.1e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene are viable and healthy but develop epileptic activity as well as reduced theta burst-induced LTP and NMDA receptor-mediated synaptic transmission in the CA1 field of the hippocampus; notably, homozygous mutant males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Serpine2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Serpine2 APN 1 79810694 missense probably damaging 0.98
IGL01386:Serpine2 APN 1 79801551 missense probably damaging 0.97
IGL02069:Serpine2 APN 1 79821412 missense possibly damaging 0.94
IGL02516:Serpine2 APN 1 79794997 unclassified probably benign
IGL02743:Serpine2 APN 1 79801555 missense probably damaging 1.00
R0372:Serpine2 UTSW 1 79821430 missense probably damaging 0.98
R1519:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R1768:Serpine2 UTSW 1 79816815 missense probably damaging 1.00
R1993:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R1995:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R2034:Serpine2 UTSW 1 79796852 missense probably damaging 1.00
R2094:Serpine2 UTSW 1 79810694 missense probably damaging 0.98
R2311:Serpine2 UTSW 1 79810548 splice site probably benign
R2312:Serpine2 UTSW 1 79802853 missense probably damaging 1.00
R2519:Serpine2 UTSW 1 79799539 missense possibly damaging 0.55
R4844:Serpine2 UTSW 1 79799524 nonsense probably null
R5141:Serpine2 UTSW 1 79802863 missense possibly damaging 0.92
R5386:Serpine2 UTSW 1 79821287 nonsense probably null
R5422:Serpine2 UTSW 1 79816875 missense probably benign 0.03
R5422:Serpine2 UTSW 1 79821489 missense probably benign 0.10
R5786:Serpine2 UTSW 1 79816920 missense probably benign 0.02
R5794:Serpine2 UTSW 1 79821439 missense probably benign
R6109:Serpine2 UTSW 1 79810671 missense probably damaging 1.00
R6514:Serpine2 UTSW 1 79821570 splice site probably null
R7001:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R7395:Serpine2 UTSW 1 79801555 missense probably damaging 1.00
R7660:Serpine2 UTSW 1 79802905 missense probably benign 0.07
R7844:Serpine2 UTSW 1 79816799 missense probably benign
R7927:Serpine2 UTSW 1 79816799 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGCATCCTCTTGGGTAC -3'
(R):5'- TTCAACTCAGCAGAATGAAAGTGAG -3'

Sequencing Primer
(F):5'- CATGGTGTTCATCCAGCTATCAATGG -3'
(R):5'- AAGTGAGCTTAGCGGTGCC -3'
Posted On2018-06-06