Incidental Mutation 'R6544:Neu2'
ID520980
Institutional Source Beutler Lab
Gene Symbol Neu2
Ensembl Gene ENSMUSG00000079434
Gene Nameneuraminidase 2
SynonymsMSS, MTS, MBS, cystolic sialidase, brain sialidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location87509889-87597845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87596742 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 150 (W150R)
Ref Sequence ENSEMBL: ENSMUSP00000131409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070898] [ENSMUST00000163606] [ENSMUST00000164128] [ENSMUST00000165109] [ENSMUST00000166055] [ENSMUST00000166259] [ENSMUST00000172222]
Predicted Effect probably damaging
Transcript: ENSMUST00000070898
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065439
Gene: ENSMUSG00000079434
AA Change: W136R

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163606
SMART Domains Protein: ENSMUSP00000127777
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
PDB:2F27|B 15 90 1e-31 PDB
SCOP:d1eur__ 19 90 1e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164128
AA Change: W142R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127913
Gene: ENSMUSG00000079434
AA Change: W142R

DomainStartEndE-ValueType
Pfam:BNR_2 38 351 1.3e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165109
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126509
Gene: ENSMUSG00000079434
AA Change: W136R

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166055
SMART Domains Protein: ENSMUSP00000132099
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
Pfam:BNR_2 32 110 8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166259
AA Change: W136R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132513
Gene: ENSMUSG00000079434
AA Change: W136R

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172222
AA Change: W150R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131409
Gene: ENSMUSG00000079434
AA Change: W150R

DomainStartEndE-ValueType
Pfam:BNR_2 46 359 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. Expression studies in COS7 cells confirmed that this gene encodes a functional sialidase. Its cytosolic localization was demonstrated by cell fractionation experiments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tdpoz2 T C 3: 93,651,960 D235G possibly damaging Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Neu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Neu2 APN 1 87596952 missense probably damaging 1.00
IGL03143:Neu2 APN 1 87596976 nonsense probably null
R0083:Neu2 UTSW 1 87597262 missense probably damaging 1.00
R0097:Neu2 UTSW 1 87597466 missense probably benign
R0097:Neu2 UTSW 1 87597466 missense probably benign
R1109:Neu2 UTSW 1 87596728 missense probably damaging 1.00
R1921:Neu2 UTSW 1 87597301 missense probably benign 0.02
R2897:Neu2 UTSW 1 87595060 missense probably benign 0.01
R2898:Neu2 UTSW 1 87595060 missense probably benign 0.01
R5395:Neu2 UTSW 1 87596675 unclassified probably null
R5867:Neu2 UTSW 1 87596756 missense probably damaging 0.96
R5868:Neu2 UTSW 1 87596756 missense probably damaging 0.96
R6468:Neu2 UTSW 1 87596878 missense probably damaging 1.00
R6610:Neu2 UTSW 1 87596685 missense probably benign 0.01
R6831:Neu2 UTSW 1 87596733 missense probably damaging 1.00
R7151:Neu2 UTSW 1 87596575 missense probably benign 0.04
R8061:Neu2 UTSW 1 87596911 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCAGTGGCAGCCTGAG -3'
(R):5'- TTTCCATGTGTGCCCATGG -3'

Sequencing Primer
(F):5'- AAGTGGTGACCCAAGCCCAG -3'
(R):5'- CATGTGTGCCCATGGTCAAG -3'
Posted On2018-06-06