Incidental Mutation 'R6519:Txnrd3'
ID520990
Institutional Source Beutler Lab
Gene Symbol Txnrd3
Ensembl Gene ENSMUSG00000000811
Gene Namethioredoxin reductase 3
SynonymsTgr, TR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R6519 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location89643988-89675529 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 89654423 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000828] [ENSMUST00000101171]
Predicted Effect probably null
Transcript: ENSMUST00000000828
SMART Domains Protein: ENSMUSP00000000828
Gene: ENSMUSG00000000811

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 9.2e-18 PFAM
Pfam:Pyr_redox_2 129 466 2.5e-66 PFAM
Pfam:FAD_binding_2 130 290 4.6e-9 PFAM
Pfam:Pyr_redox 309 386 9.6e-16 PFAM
Pfam:Pyr_redox_dim 486 599 2.7e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101171
SMART Domains Protein: ENSMUSP00000098730
Gene: ENSMUSG00000000811

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Glutaredoxin 40 102 1.5e-18 PFAM
Pfam:Thi4 116 222 3.9e-7 PFAM
Pfam:FAD_binding_2 130 264 3.7e-9 PFAM
Pfam:Pyr_redox_2 130 342 2.9e-24 PFAM
Pfam:Pyr_redox_dim 372 485 2.8e-31 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 91.7%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: This gene encodes a member of the family of pyridine nucleotide oxidoreductases. This protein catalyzes the reduction of thioredoxin, but unlike other mammalian thioredoxin reductases (TRs), it contains an additional glutaredoxin domain, and shows highest expression in testes. Like other TRs, it contains a C-terminal, penultimate selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. There is also evidence for the use of a non-AUG (CUG) translation initiation site upstream of, and in-frame with the first AUG, leading to additional isoforms. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt T C 9: 99,613,670 I53T probably damaging Het
Adgrv1 C T 13: 81,567,343 D909N probably benign Het
Ahdc1 T C 4: 133,064,768 Y1107H possibly damaging Het
Aldob A T 4: 49,543,835 V49E probably damaging Het
Apol6 T A 15: 77,051,276 Y248* probably null Het
Apol7b T A 15: 77,423,348 T316S probably benign Het
Atp13a2 G C 4: 141,000,854 R503P possibly damaging Het
BC037034 A G 5: 138,261,848 S344P probably damaging Het
Brca2 A C 5: 150,540,979 T1403P probably damaging Het
Casc4 T C 2: 121,906,737 V141A probably benign Het
Cblc T C 7: 19,792,863 Y148C probably damaging Het
Cct7 C A 6: 85,462,150 Q149K probably benign Het
Cd53 T A 3: 106,762,145 H179L probably benign Het
Cyp2b19 A G 7: 26,759,111 T84A probably benign Het
Cyp3a41a A G 5: 145,715,498 C64R probably damaging Het
Dclre1c T C 2: 3,429,329 Y75H probably damaging Het
Dhx35 A T 2: 158,831,710 I354F probably damaging Het
Diaph3 T C 14: 86,966,335 N629S probably damaging Het
Dnase1 A T 16: 4,038,589 S132C probably damaging Het
Dnttip2 T C 3: 122,275,471 S112P probably benign Het
Eif4g3 C A 4: 137,994,008 P48T probably benign Het
Fat4 A T 3: 39,002,871 T4239S probably benign Het
Fbn2 A G 18: 58,063,575 V1419A possibly damaging Het
Ghitm A C 14: 37,125,247 M290R probably damaging Het
Glb1l T C 1: 75,201,056 D406G probably benign Het
Glipr1l1 C A 10: 112,062,248 A86D probably benign Het
Grm7 C T 6: 111,207,752 A348V probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdac2 T A 10: 36,989,256 N155K probably damaging Het
Hus1b A G 13: 30,946,947 I243T probably benign Het
Kcnab2 T C 4: 152,411,993 T65A probably damaging Het
Lasp1 T A 11: 97,815,557 probably null Het
Lrch3 G A 16: 32,994,997 probably benign Het
Ltb4r2 C T 14: 55,762,981 T353M probably benign Het
Macf1 A G 4: 123,472,325 M1316T probably benign Het
Msr1 G A 8: 39,624,221 T116I probably benign Het
Nlrp5 A G 7: 23,417,918 I356V probably benign Het
Npy C T 6: 49,823,689 S31F possibly damaging Het
Nsd3 C T 8: 25,662,939 P432S probably damaging Het
Nup160 A C 2: 90,718,217 R1037S probably damaging Het
Olfr284 C T 15: 98,340,048 G314R probably benign Het
Olfr32 A T 2: 90,138,812 I109N possibly damaging Het
Olfr533 T A 7: 140,466,545 S115T probably benign Het
Pcx A G 19: 4,602,211 E108G possibly damaging Het
Pecam1 A T 11: 106,699,642 M102K probably benign Het
Pgd G T 4: 149,150,886 Y433* probably null Het
Pkd1l3 A G 8: 109,628,772 E744G probably benign Het
Rb1 A G 14: 73,298,063 I118T probably benign Het
Rdh11 T A 12: 79,182,815 H228L probably damaging Het
Rnf44 C T 13: 54,681,786 R340Q probably damaging Het
Rtraf A G 14: 19,819,930 V88A possibly damaging Het
Sigmar1 T C 4: 41,739,380 T185A possibly damaging Het
Thsd1 A G 8: 22,259,065 R590G probably damaging Het
Trbv19 T C 6: 41,178,639 probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Xpnpep1 T C 19: 53,011,844 N192D possibly damaging Het
Zfp955b T A 17: 33,302,077 S173R possibly damaging Het
Zranb1 T A 7: 132,950,128 C195* probably null Het
Other mutations in Txnrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Txnrd3 APN 6 89654147 missense probably benign 0.15
IGL01763:Txnrd3 APN 6 89661555 missense probably damaging 0.97
IGL02159:Txnrd3 APN 6 89669324 missense probably damaging 1.00
IGL02238:Txnrd3 APN 6 89656135 missense probably benign 0.02
IGL02452:Txnrd3 APN 6 89674795 makesense probably null
R1054:Txnrd3 UTSW 6 89650561 nonsense probably null
R3522:Txnrd3 UTSW 6 89663075 critical splice acceptor site probably null
R5108:Txnrd3 UTSW 6 89673034 missense probably benign 0.33
R5653:Txnrd3 UTSW 6 89654085 missense probably benign 0.25
R6159:Txnrd3 UTSW 6 89663194 critical splice donor site probably null
R6246:Txnrd3 UTSW 6 89651541 missense probably benign 0.01
R6661:Txnrd3 UTSW 6 89654152 nonsense probably null
R6685:Txnrd3 UTSW 6 89669915 missense possibly damaging 0.84
R7353:Txnrd3 UTSW 6 89661585 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGATGGTGTCTGGCAAATTC -3'
(R):5'- ATAGCATATGCACTGGGCCTG -3'

Sequencing Primer
(F):5'- GTGTCTGGCAAATTCAGATGTTCAC -3'
(R):5'- CACTGGGCCTGCAACAGTAAG -3'
Posted On2018-06-06