Mutagenetix > Incidental Mutation

Incidental Mutation 'R6519:Grm7'

520993

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6519 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110645581-111567230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 111207752 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 348 (A348V)

Ref Sequence

ENSEMBL: ENSMUSP00000133957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

AlphaFold

Q68ED2

Predicted Effect

probably benign
Transcript: ENSMUST00000071076
AA Change: A348V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: A348V

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172951
AA Change: A348V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: A348V

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174018

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 91.7%

Validation Efficiency

97% (58/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4gnt	T	C	9: 99,613,670	I53T	probably damaging	Het
Adgrv1	C	T	13: 81,567,343	D909N	probably benign	Het
Ahdc1	T	C	4: 133,064,768	Y1107H	possibly damaging	Het
Aldob	A	T	4: 49,543,835	V49E	probably damaging	Het
Apol6	T	A	15: 77,051,276	Y248*	probably null	Het
Apol7b	T	A	15: 77,423,348	T316S	probably benign	Het
Atp13a2	G	C	4: 141,000,854	R503P	possibly damaging	Het
BC037034	A	G	5: 138,261,848	S344P	probably damaging	Het
Brca2	A	C	5: 150,540,979	T1403P	probably damaging	Het
Casc4	T	C	2: 121,906,737	V141A	probably benign	Het
Cblc	T	C	7: 19,792,863	Y148C	probably damaging	Het
Cct7	C	A	6: 85,462,150	Q149K	probably benign	Het
Cd53	T	A	3: 106,762,145	H179L	probably benign	Het
Cyp2b19	A	G	7: 26,759,111	T84A	probably benign	Het
Cyp3a41a	A	G	5: 145,715,498	C64R	probably damaging	Het
Dclre1c	T	C	2: 3,429,329	Y75H	probably damaging	Het
Dhx35	A	T	2: 158,831,710	I354F	probably damaging	Het
Diaph3	T	C	14: 86,966,335	N629S	probably damaging	Het
Dnase1	A	T	16: 4,038,589	S132C	probably damaging	Het
Dnttip2	T	C	3: 122,275,471	S112P	probably benign	Het
Eif4g3	C	A	4: 137,994,008	P48T	probably benign	Het
Fat4	A	T	3: 39,002,871	T4239S	probably benign	Het
Fbn2	A	G	18: 58,063,575	V1419A	possibly damaging	Het
Ghitm	A	C	14: 37,125,247	M290R	probably damaging	Het
Glb1l	T	C	1: 75,201,056	D406G	probably benign	Het
Glipr1l1	C	A	10: 112,062,248	A86D	probably benign	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Hdac2	T	A	10: 36,989,256	N155K	probably damaging	Het
Hus1b	A	G	13: 30,946,947	I243T	probably benign	Het
Kcnab2	T	C	4: 152,411,993	T65A	probably damaging	Het
Lasp1	T	A	11: 97,815,557		probably null	Het
Lrch3	G	A	16: 32,994,997		probably benign	Het
Ltb4r2	C	T	14: 55,762,981	T353M	probably benign	Het
Macf1	A	G	4: 123,472,325	M1316T	probably benign	Het
Msr1	G	A	8: 39,624,221	T116I	probably benign	Het
Nlrp5	A	G	7: 23,417,918	I356V	probably benign	Het
Npy	C	T	6: 49,823,689	S31F	possibly damaging	Het
Nsd3	C	T	8: 25,662,939	P432S	probably damaging	Het
Nup160	A	C	2: 90,718,217	R1037S	probably damaging	Het
Olfr284	C	T	15: 98,340,048	G314R	probably benign	Het
Olfr32	A	T	2: 90,138,812	I109N	possibly damaging	Het
Olfr533	T	A	7: 140,466,545	S115T	probably benign	Het
Pcx	A	G	19: 4,602,211	E108G	possibly damaging	Het
Pecam1	A	T	11: 106,699,642	M102K	probably benign	Het
Pgd	G	T	4: 149,150,886	Y433*	probably null	Het
Pkd1l3	A	G	8: 109,628,772	E744G	probably benign	Het
Rb1	A	G	14: 73,298,063	I118T	probably benign	Het
Rdh11	T	A	12: 79,182,815	H228L	probably damaging	Het
Rnf44	C	T	13: 54,681,786	R340Q	probably damaging	Het
Rtraf	A	G	14: 19,819,930	V88A	possibly damaging	Het
Sigmar1	T	C	4: 41,739,380	T185A	possibly damaging	Het
Thsd1	A	G	8: 22,259,065	R590G	probably damaging	Het
Trbv19	T	C	6: 41,178,639		probably benign	Het
Txnrd3	T	C	6: 89,654,423		probably null	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Xpnpep1	T	C	19: 53,011,844	N192D	possibly damaging	Het
Zfp955b	T	A	17: 33,302,077	S173R	possibly damaging	Het
Zranb1	T	A	7: 132,950,128	C195*	probably null	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111246184	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111358317	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111358958	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111254020	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111495643	splice site	probably null
IGL03185:Grm7	APN	6	110646222	missense	possibly damaging	0.84
Appropriated	UTSW	6	111495681	missense	possibly damaging	0.64
Consumed	UTSW	6	111358875	missense	probably damaging	1.00
Devoured	UTSW	6	111358824	missense	probably damaging	1.00
shaky	UTSW	6	111495791	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110646089	missense	probably benign
R0539:Grm7	UTSW	6	111359094	splice site	probably benign
R0622:Grm7	UTSW	6	111358496	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111359024	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111495791	nonsense	probably null
R1823:Grm7	UTSW	6	111207769	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111080423	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111358607	missense	probably benign
R1987:Grm7	UTSW	6	110914511	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111207808	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110646137	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111358997	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111495681	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111495905	splice site	probably null
R2923:Grm7	UTSW	6	111495905	splice site	probably null
R3014:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111495722	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110914340	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111254020	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110914364	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111246374	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111358304	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110914546	splice site	probably null
R4647:Grm7	UTSW	6	110914383	nonsense	probably null
R4714:Grm7	UTSW	6	111080422	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110914371	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111358863	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111080443	missense	probably damaging	0.99
R5062:Grm7	UTSW	6	110646136	missense	probably damaging	1.00
R5256:Grm7	UTSW	6	111358221	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111358426	missense	probably benign
R6026:Grm7	UTSW	6	111501539	nonsense	probably null
R6174:Grm7	UTSW	6	111246297	missense	probably benign
R6305:Grm7	UTSW	6	111358665	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111358875	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111254020	missense	probably damaging	1.00
R6531:Grm7	UTSW	6	111358425	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111358353	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	110646304	missense	probably benign	0.03
R6949:Grm7	UTSW	6	111495729	missense	probably damaging	1.00
R6989:Grm7	UTSW	6	111207805	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111358152	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111358824	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110646118	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110646013	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111501515	missense
R7567:Grm7	UTSW	6	111358761	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111246353	nonsense	probably null
R8018:Grm7	UTSW	6	111207776	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111566039	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110914336	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111080354	missense	probably benign
R8523:Grm7	UTSW	6	111246319	missense	possibly damaging	0.76
R8816:Grm7	UTSW	6	111254005	missense	possibly damaging	0.46
R8958:Grm7	UTSW	6	111495822	missense	probably damaging	0.96
R9135:Grm7	UTSW	6	111495768	missense	probably benign	0.39
R9207:Grm7	UTSW	6	111358913	missense	probably damaging	1.00
R9210:Grm7	UTSW	6	110645908	missense	probably benign	0.01
R9438:Grm7	UTSW	6	111254116	missense	possibly damaging	0.94
R9448:Grm7	UTSW	6	111358232	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358149	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCTGATTTAGCTCACTAGAAATG -3'
(R):5'- TTCTATGTAAAGTTGCAGGAGGAAGAC -3'

Sequencing Primer
(F):5'- TGGGTCTTCAGTGAAAATAAAGC -3'
(R):5'- AAGACAACGGGAATGAAATTACC -3'

Posted On

2018-06-06