Incidental Mutation 'R6544:Tdpoz2'
ID520998
Institutional Source Beutler Lab
Gene Symbol Tdpoz2
Ensembl Gene ENSMUSG00000103362
Gene NameTD and POZ domain containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.506) question?
Stock #R6544 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93651542-93652686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93651960 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 235 (D235G)
Ref Sequence ENSEMBL: ENSMUSP00000141299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191960]
Predicted Effect possibly damaging
Transcript: ENSMUST00000191960
AA Change: D235G

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141299
Gene: ENSMUSG00000103362
AA Change: D235G

DomainStartEndE-ValueType
MATH 24 130 1.27e-6 SMART
BTB 188 287 7.44e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,058,957 K118* probably null Het
Actr2 A G 11: 20,100,933 F17L probably damaging Het
Adam26b T C 8: 43,521,781 I61M probably damaging Het
Ahnak2 A G 12: 112,780,652 probably benign Het
Angptl3 T C 4: 99,031,438 L145P probably damaging Het
Ank2 T C 3: 126,933,222 T808A probably damaging Het
Cadm3 A G 1: 173,367,411 probably null Het
Cog7 C T 7: 121,935,743 R573Q probably damaging Het
Dchs1 T A 7: 105,758,178 I2110F probably damaging Het
Fbxo47 G A 11: 97,856,263 R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 D583V probably damaging Het
Gigyf1 T A 5: 137,525,059 L911Q probably damaging Het
Gm35339 T C 15: 76,358,278 Y823H probably benign Het
Gm4737 A C 16: 46,154,784 S77A probably benign Het
Gprin1 G A 13: 54,740,311 A50V possibly damaging Het
Grik4 A T 9: 42,547,728 Y571* probably null Het
Gucy2e A G 11: 69,235,657 V299A probably benign Het
Hectd2 C T 19: 36,612,328 L618F probably damaging Het
Lactbl1 A T 4: 136,632,989 I160F possibly damaging Het
Lats1 T A 10: 7,701,670 V186D possibly damaging Het
Lmtk2 A G 5: 144,173,806 H448R possibly damaging Het
Map10 T C 8: 125,671,374 I502T probably benign Het
Mok A G 12: 110,810,755 F239S probably damaging Het
Mprip G A 11: 59,757,726 G752D probably benign Het
Naip5 C A 13: 100,223,144 G528V possibly damaging Het
Neu2 T C 1: 87,596,742 W150R probably damaging Het
Olfr1111 T A 2: 87,149,863 Y266F probably damaging Het
Olfr1156 T A 2: 87,949,991 M81L probably benign Het
Olfr1434 T C 19: 12,283,155 Y36H probably damaging Het
Olfr356 T A 2: 36,937,527 M136K possibly damaging Het
Pip5k1c T A 10: 81,308,996 Y224N probably damaging Het
Plch1 T C 3: 63,850,978 E5G probably damaging Het
Pspc1 T C 14: 56,764,203 *59W probably null Het
Ptprq T C 10: 107,608,241 T1501A probably damaging Het
Rnf165 T A 18: 77,563,235 probably benign Het
Rorb G T 19: 18,952,250 P304T possibly damaging Het
Scn7a A T 2: 66,684,100 L1110Q probably damaging Het
Serpine2 C T 1: 79,803,130 probably null Het
Slco1c1 A G 6: 141,531,444 probably null Het
Smarca2 T A 19: 26,630,931 V130D probably damaging Het
Sox17 G T 1: 4,492,432 P117T possibly damaging Het
Sparcl1 A T 5: 104,092,444 Y371* probably null Het
Tns2 A C 15: 102,113,834 K1182N possibly damaging Het
Tpte G T 8: 22,315,105 probably null Het
Ttn A T 2: 76,969,159 I459K possibly damaging Het
Zc3h15 G A 2: 83,661,148 R240H probably benign Het
Zfp455 C A 13: 67,207,057 L130I probably benign Het
Zfp777 A T 6: 48,044,485 S68T probably damaging Het
Other mutations in Tdpoz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Tdpoz2 APN 3 93652428 missense possibly damaging 0.48
IGL02285:Tdpoz2 APN 3 93652291 missense probably damaging 1.00
IGL02350:Tdpoz2 APN 3 93652428 missense possibly damaging 0.48
IGL02357:Tdpoz2 APN 3 93652428 missense possibly damaging 0.48
IGL02887:Tdpoz2 APN 3 93651739 missense probably benign 0.43
FR4304:Tdpoz2 UTSW 3 93651615 frame shift probably null
FR4340:Tdpoz2 UTSW 3 93651615 frame shift probably null
R1502:Tdpoz2 UTSW 3 93652146 missense probably benign 0.01
R1943:Tdpoz2 UTSW 3 93651923 nonsense probably null
R4825:Tdpoz2 UTSW 3 93652074 missense possibly damaging 0.58
R5055:Tdpoz2 UTSW 3 93651928 missense probably damaging 1.00
R5096:Tdpoz2 UTSW 3 93652512 missense possibly damaging 0.87
R5398:Tdpoz2 UTSW 3 93652134 missense probably damaging 0.97
R6178:Tdpoz2 UTSW 3 93652311 missense probably benign 0.01
R6280:Tdpoz2 UTSW 3 93651883 missense probably benign 0.03
R6338:Tdpoz2 UTSW 3 93652336 missense probably benign 0.30
R6954:Tdpoz2 UTSW 3 93652275 missense probably damaging 1.00
R7351:Tdpoz2 UTSW 3 93652593 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTCAGCTGCTCTGTGCTATGG -3'
(R):5'- AGATGACCTAGGCAAGCTGTG -3'

Sequencing Primer
(F):5'- GAGTGTGTGCAGCATTCTCCAC -3'
(R):5'- GCAAGCTGTGGGAGAATTCC -3'
Posted On2018-06-06