Incidental Mutation 'R6544:Angptl3'
ID 521004
Institutional Source Beutler Lab
Gene Symbol Angptl3
Ensembl Gene ENSMUSG00000028553
Gene Name angiopoietin-like 3
Synonyms hypl
MMRRC Submission 044670-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.213) question?
Stock # R6544 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 98919191-98926429 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98919675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 145 (L145P)
Ref Sequence ENSEMBL: ENSMUSP00000030280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030280] [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold Q9R182
Predicted Effect probably damaging
Transcript: ENSMUST00000030280
AA Change: L145P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030280
Gene: ENSMUSG00000028553
AA Change: L145P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
Blast:FBG 195 240 6e-8 BLAST
FBG 241 454 1.5e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030286
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075836
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125546
Predicted Effect probably benign
Transcript: ENSMUST00000127417
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136091
Predicted Effect probably benign
Transcript: ENSMUST00000205650
Meta Mutation Damage Score 0.2328 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the angiopoietin-like family of proteins. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may inhibit triglyceride metabolism. Homozygous knockout mice for this gene exhibit reduced plasma lipid concentrations, including reduced plasma triglyceride concentrations, and enhanced activity of enzymes involved in triglyceride metabolism. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene display decreased plasma cholesterol and triglyceride levels. A spontaneous mutation results in a similar phenotype except that there is also a reduction in fat pad weight and decreased free fatty acid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005K14Rik T A 1: 83,036,678 (GRCm39) K118* probably null Het
Actr2 A G 11: 20,050,933 (GRCm39) F17L probably damaging Het
Adam26b T C 8: 43,974,818 (GRCm39) I61M probably damaging Het
Ahcyl A C 16: 45,975,147 (GRCm39) S77A probably benign Het
Ahnak2 A G 12: 112,746,829 (GRCm39) probably benign Het
Ank2 T C 3: 126,726,871 (GRCm39) T808A probably damaging Het
Ark2c T A 18: 77,650,931 (GRCm39) probably benign Het
Cadm3 A G 1: 173,194,977 (GRCm39) probably null Het
Cog7 C T 7: 121,534,966 (GRCm39) R573Q probably damaging Het
Dchs1 T A 7: 105,407,385 (GRCm39) I2110F probably damaging Het
Fbxo47 G A 11: 97,747,089 (GRCm39) R326C probably damaging Het
Frmpd1 A T 4: 45,279,024 (GRCm39) D583V probably damaging Het
Gigyf1 T A 5: 137,523,321 (GRCm39) L911Q probably damaging Het
Gprin1 G A 13: 54,888,124 (GRCm39) A50V possibly damaging Het
Grik4 A T 9: 42,459,024 (GRCm39) Y571* probably null Het
Gucy2e A G 11: 69,126,483 (GRCm39) V299A probably benign Het
Hectd2 C T 19: 36,589,728 (GRCm39) L618F probably damaging Het
Lactbl1 A T 4: 136,360,300 (GRCm39) I160F possibly damaging Het
Lats1 T A 10: 7,577,434 (GRCm39) V186D possibly damaging Het
Lmtk2 A G 5: 144,110,624 (GRCm39) H448R possibly damaging Het
Map10 T C 8: 126,398,113 (GRCm39) I502T probably benign Het
Mok A G 12: 110,777,189 (GRCm39) F239S probably damaging Het
Mprip G A 11: 59,648,552 (GRCm39) G752D probably benign Het
Naip5 C A 13: 100,359,652 (GRCm39) G528V possibly damaging Het
Neu2 T C 1: 87,524,464 (GRCm39) W150R probably damaging Het
Or1ak2 T A 2: 36,827,539 (GRCm39) M136K possibly damaging Het
Or5an1 T C 19: 12,260,519 (GRCm39) Y36H probably damaging Het
Or5as1 T A 2: 86,980,207 (GRCm39) Y266F probably damaging Het
Or5l13 T A 2: 87,780,335 (GRCm39) M81L probably benign Het
Pip5k1c T A 10: 81,144,830 (GRCm39) Y224N probably damaging Het
Plch1 T C 3: 63,758,399 (GRCm39) E5G probably damaging Het
Pspc1 T C 14: 57,001,660 (GRCm39) *59W probably null Het
Ptprq T C 10: 107,444,102 (GRCm39) T1501A probably damaging Het
Rorb G T 19: 18,929,614 (GRCm39) P304T possibly damaging Het
Scn7a A T 2: 66,514,444 (GRCm39) L1110Q probably damaging Het
Serpine2 C T 1: 79,780,847 (GRCm39) probably null Het
Slco1c1 A G 6: 141,477,170 (GRCm39) probably null Het
Smarca2 T A 19: 26,608,331 (GRCm39) V130D probably damaging Het
Sox17 G T 1: 4,562,655 (GRCm39) P117T possibly damaging Het
Sparcl1 A T 5: 104,240,310 (GRCm39) Y371* probably null Het
Tdpoz2 T C 3: 93,559,267 (GRCm39) D235G possibly damaging Het
Tns2 A C 15: 102,022,269 (GRCm39) K1182N possibly damaging Het
Tpte G T 8: 22,805,121 (GRCm39) probably null Het
Ttn A T 2: 76,799,503 (GRCm39) I459K possibly damaging Het
Wdr97 T C 15: 76,242,478 (GRCm39) Y823H probably benign Het
Zc3h15 G A 2: 83,491,492 (GRCm39) R240H probably benign Het
Zfp455 C A 13: 67,355,121 (GRCm39) L130I probably benign Het
Zfp777 A T 6: 48,021,419 (GRCm39) S68T probably damaging Het
Other mutations in Angptl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Angptl3 APN 4 98,923,077 (GRCm39) missense probably damaging 0.99
IGL01859:Angptl3 APN 4 98,925,669 (GRCm39) nonsense probably null
IGL02126:Angptl3 APN 4 98,919,738 (GRCm39) critical splice donor site probably null
IGL02134:Angptl3 APN 4 98,919,349 (GRCm39) missense probably damaging 1.00
IGL02573:Angptl3 APN 4 98,926,171 (GRCm39) missense probably damaging 1.00
IGL02756:Angptl3 APN 4 98,919,399 (GRCm39) missense probably damaging 1.00
IGL03369:Angptl3 APN 4 98,923,057 (GRCm39) intron probably benign
R0309:Angptl3 UTSW 4 98,922,706 (GRCm39) missense probably benign 0.32
R0549:Angptl3 UTSW 4 98,919,692 (GRCm39) missense probably benign 0.00
R0675:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1465:Angptl3 UTSW 4 98,925,757 (GRCm39) missense probably benign 0.01
R1738:Angptl3 UTSW 4 98,921,499 (GRCm39) missense probably benign 0.02
R2007:Angptl3 UTSW 4 98,925,634 (GRCm39) missense probably damaging 0.99
R2656:Angptl3 UTSW 4 98,926,201 (GRCm39) missense probably benign 0.01
R3436:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3437:Angptl3 UTSW 4 98,921,540 (GRCm39) missense probably benign 0.24
R3615:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R3616:Angptl3 UTSW 4 98,922,702 (GRCm39) missense probably benign 0.06
R4161:Angptl3 UTSW 4 98,919,728 (GRCm39) missense probably damaging 0.99
R4534:Angptl3 UTSW 4 98,926,232 (GRCm39) missense possibly damaging 0.73
R4615:Angptl3 UTSW 4 98,919,598 (GRCm39) missense probably benign 0.03
R4835:Angptl3 UTSW 4 98,925,649 (GRCm39) missense probably benign 0.36
R5308:Angptl3 UTSW 4 98,922,723 (GRCm39) missense probably benign 0.33
R5413:Angptl3 UTSW 4 98,919,259 (GRCm39) missense probably benign 0.12
R5668:Angptl3 UTSW 4 98,920,321 (GRCm39) critical splice acceptor site probably null
R5906:Angptl3 UTSW 4 98,925,804 (GRCm39) missense probably benign 0.07
R6520:Angptl3 UTSW 4 98,926,085 (GRCm39) missense probably benign 0.35
R6762:Angptl3 UTSW 4 98,925,654 (GRCm39) missense possibly damaging 0.91
R7889:Angptl3 UTSW 4 98,919,308 (GRCm39) missense probably benign 0.00
R8305:Angptl3 UTSW 4 98,919,548 (GRCm39) missense probably damaging 1.00
R8690:Angptl3 UTSW 4 98,925,759 (GRCm39) missense probably benign 0.00
R9284:Angptl3 UTSW 4 98,919,480 (GRCm39) missense probably benign 0.00
Z1088:Angptl3 UTSW 4 98,922,757 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCTATCACTTCGAACCAATG -3'
(R):5'- ATGTTAGCAAAGCAAACCCTG -3'

Sequencing Primer
(F):5'- TCACTTCGAACCAATGAAATCAAAG -3'
(R):5'- TGTTAGCAAAGCAAACCCTGAACTG -3'
Posted On 2018-06-06